Description :
From Genome Similarity Track
Location :
Scaffold_53:87414- 89044
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16032callose synthase

Sequence
1630 bases(100 bases per row)
ACAAGCACGAAGAGGTCATTGATATGACGTCTCCCAACCCGGCTATGATCTACAAACAGAAGCAGCAACAACGTCAGGGTCAGGGGCTAGCTGGTCTGGC
TGGTCTTGGTGGGCGAGGTGGGCTCAACGGTGGCTCGAATAGCTCGACGTTTTACAACAAGCGTAAAAGTATTGCTGAGGGGTTCACCGAGTCGGCGAAG
ACTTTCGTAGAGAAGCGGACGTGGCTGCTGCCTCTTCGCGCTTTCAACCGCATCTTCAACTTCCACGTGATCGCGTTCCACTTCCTGGCAGCGCTTGCGT
TCGCGAATGAGCAAGAGATGAATTTCCTGGACTCCTGCAAGATTATTTCGAGCACCCTGATCACTCCTTTCTTGCTGGACATTCTCCGCGATGGACTCGA
TATCTTCGCTGTATACGACGAGCACCAGAAGTTGTTCTCGACGGCGCGTAACATTTTGCGTGTGTTCCTGCACCTGGGGCTTGCGGTGGTGACTTCAATA
CTGTACTGGTATGCGTGGGCTTACGGTGGTGCGTGGTGGCAGACGTACTACGTGACCGCAGTGCTTTTCCACGTGCCAGGTCTGATTAACTGCGTCATGC
AGGTAATGCCTGGTCTTACCAACTGGACCCGACGCACGACGTTTGCTCCTGTCGCATTTATCCGTGACATTATGAGTCCGATGAACCGCCTGTATGTTGG
TGACAACGTGCTGGACCCGGAATCGATGAGTGTGGGCTATCAGTGCTTCTGGATGTCGCAGCTGGCTTGGAAGTTATACTTCAGCTACAAGTTTGAAATC
TACCCGCTTGTGGTCCCGAGCTTTTTGCTGTATGCTGACCACGTGGAGAACAAGGTGAGCATGATTACGACGGTGTTCCTTATCTTCCTGAACTGGATGC
CGTTCTTCTTGGTGTTCTGCGTTGATATTACGATTTGGAATTCGATCTGGATGGCGTTCACGGGTACTTTTGTCGGCTTTTCATCACACATTGGCGAGAT
TCGCAATTTCACTCGTGTTCGCTCTGCGTTTAGCCGTGCTGTGGATGCTTTTAACGCTAAGGTGATCGCACGAAGCTCCAAGACGGGACTCCAACTTTCG
GACAGCAATGGTATGTCGTACGGCTCGACAGCCTTGGGACGTGAAGTGCTCGATCGTGTTGCGGGTGGTGCGGATCCGACGGCCCGAATCCTGTCCCAGC
GTCGTACTTCGGCTCATGATGACGAGACTCCGTTGCTGTCTTTCTCACGTCGTAAGCAGACGCCTATGGAGCGCCAAGCTGCACGTCGTCGCAAGTGGTT
CTCATTTTCGGTGGCTTGGGACACAATCATCGATAGTATGCGCGCGGACGATTTGATCTCGAACAAAGAGAAATCTCTGCTTCAATTTCACCGGCTGGAC
GGCTACCAGCGTGAGATTTACCTGCCGCAGTTCCAGCTTGCTGGTTGCTTTGAGAACTTCACGTCGAATATTCTTGACATTTATTCATCTAATGACGGCA
ATGTCTCAGAGCGTGTTCTGCAAGACAAGCTGCTGGAAATCCTCAGTGATAACCCAATGGTGGAGGAGTCTCTCGAAGAGATCTGGGAGCTTGCGAACTG
GGTGCTGGTCAATGTGCTTGGTCCCTGCCA