Description :
From Genome Similarity Track
Location :
Scaffold_280:8740- 9952
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20085hypothetical protein

Sequence
1212 bases(100 bases per row)
GGCGCTGTAGTGGCGTGTGCGATGATTGCAACTCCATTTGGCAAAATCTTTCTCAAGTGGAGAGTTTTGCAACTGGAGCTGAACTCCGTCACCGAAGCGA
GAAGGCACAAATGGAGCGAATTGCGGAGTGAACAGGACTCGGATTGTTCGTGCGTGGCTCATGTGCTGTGCCATTTGGTTGGACGAGCCAGGTGGACTCA
AATTGTACGTGGCCGAGCAGAGAAGCAGCCATCGAAGTCACTTGCCATTCTACGGTCGAGACCCACTCAAAAAATTATCCAATTGGATGGGATCTGGCTT
TTTTAATCAAGGTCGGAATGTGTCTCTGTCCAAAGTTTGAAGTCCCATCTGAACTAAGAACACTTCATTTTACTAAAGGATGGAAAATAGAACGGCGAAT
AGTGACTTTTTCGTTTGAACGATGCTACATTACTAACACAACACCAAAATGAGACTTGAAGGAATTGAAGGAATGACCACCGCGATGTGAGGGCCTTCGA
TTTGGATGGACCGTTGAATCCTTGCGTTCGAGCTTTGTCTCCTTTCAGGGAGGTTGTCTGACCACAGATTGACTGCGGAGAAGCCGTCATCCTACATCGC
CTGGATCCCACAATGTAGCGACCAAAAGTGCAGTTTAGAAGCTTGCCGAATCACCAGCACTGATGCATCCTCTGCGACTGTATTTGCATAGAGCGCTATT
GCATCCGCCACTTTCCTCACGTCGCAGAGCAGTTCGCAATCGAGCACCCACTCGTCGTAATCGCGTGACTTTCTGACTCAAATTTGCCACAAAACAACAT
TAGGCCCGCAATATTGCGGAGAAGGCATGTGTTGCCATCCCATAGTAAGGTTCAGATCCACTAGGTTGCGTTACTTGCGCTACGTTTGGAGTGCTGTGGT
GACGCGACCACGCCATCAAATTTAGTCCAATGTTCTGGAAGCAACACCACGCGCTTCCTCAAGATTTGACTTGAACACATCTGAGCAAAATGCCGAAGCT
GTGCCTGTGCAACAACTCTCTAGGATCACAAAAGCGATAGGCGAGCTGAAAAGTTGGAAAGTATCTTTGTGCTGTGCTACCCAAAGTCTGGATCATTTGA
GACTCTACGCTACAGGCCTTCCACAACGGGCTGTTCTCAGCCTTTGTCGTCAAATTCAGTCCGTTGCACCTTCGAGAGAATGTGAAAGAAAAATTTAACT
CGAATGACGGAA