Description :
From Genome Similarity Track
Location :
Scaffold_28:874- 4052
Sequence
3178 bases(100 bases per row)
tatttcactgctgtaattcccgtacacacttccacattgatgtgacagttgtacttttgggaaaagtaggggttgtagggcaccacccactggttagcag
tttcattgtcgtacttccgccccccgatcttaaggtcctcaccagtttgaggacggcggcgccgtcggtacactggatagccgtcaacgtttgcacgggt
ggtttcttctaatgtttttgggaaacctttggagcaccgcccgtccttcatacagggagagtccgggttttgaataccacagggcccatgcatcatgcaa
gttgtaacggtcttgtacaactctgtattggtagcctcatcgggtatctcagcggacaccaacttgtcaataatcactctcgtgcgtggtttaccttcgt
cagcaaggatgattagaatgtgtgcgtgtggaaggcctcgcttttgaaactcaacaacgtagatcctagctagaactcgacccaacacaccttcgtccaa
gtcggccagaagggctctaactgccacacgcgagctacaatgtctggacgatctgaagctttttggccatctggaagttgtccaacaatttcatcccacc
caggattgcaggtcatcgtaaggaaaacgtctggttttccgtactcacggacaattgccatcgagtcttagtaggacttatacatttgccgaggtccacc
cgtgtaagtcgccggaagaataacgcgtttggctgttcaatccaggaagtatttccgacgggcctactgcggtggttgagggttatccatgtcatacgta
gcattcctccgttcatactcagtgaatcgtacttcaccctcagccaaatcatccgctgactcgcctaggtatgcgtcctgtgcaccaatgtagaggtccg
cacgaagtgttttttttttttttctgaaacccatcgtaaagcctcttgttcaaccttggctctttgatcaacattccactgctgaaacagacgaccgcca
ctgtgcaacacggaaccgtctcccggttttgggaacaaccgataggcaacatgttcgcggagcgacatttcttctttgttgcggtattttggccgtttgc
gtatttgtcagtgtaggtccagcccaactctccaagcggaaatagtagcggatattacagtggatcgtacatcgggttggtttcgaaaaatcgcaacagc
ccgttttgtcgagtacagtaacaaatcccagtacttcgtgaagttttcaccgtcaatcatcaccgcgcccacttcatttgcagtcggcaagtttgtgttc
ctggcatgcgtttatccgcgtacaaccttagcttcaggtccataacgggcttgccttccactaaatcttgccgtagtttttccccatgagatagatattg
ttaggcaaacgggttgtagcattgtatcaatctctccactgttgtcaactttcacaatcaaatcggcgaaaattcccttcacccgctccactcttctttg
tagatcaccgtcaaagatgtagatttgagcaaactccgcaggcgcgaaattcccactgtcgtattccatacggggaagcagcgatcccaagtagtgcccc
atagccccctggatgcgataggtatacactccacgctgtccctggacagatctgtcttcctttactccttgcacgccaacaccatcactacgtgcagcac
cgactaatgtaaatgcaaaaacttggttgtaggcccgaattaaccgacgaaaatcagggtcgtcgtagtagtggtgtagatattccggcgccctgtgtag
cggagaaagccgaaccttaccttgcacacagcaagctattttggactcccccggtcacttccaggcagacaccaaccgcattcatgcatgtttgggagat
tgtgttgtccgtcttccacgtcttttccagaaacgcgatctttatcaaacgcctcatgatttgctagcgcatgctcgcgccacacgcatttgcgacgaat
acggagagcttccttgcctgcttcttgcacgtcttccccctttgcttcccgatgggcacgctcacgctcacgctgagcctcttgctcctccacaatcatt
tcactacgacattcctgtcgtcgttgcctattttgatgtgcccgttgacccggcgcgagtgctacacgcaattcttggcgacgctgtgggttgtgcattt
actcagcgatttattcttccgttgtaagttgtgcgcgatgaatctggcactgttacttgtcccgctgacgctctaaccctagctcctccgctgaaagccg
ttctcgatgcaaacgttgtcgttccgcctcactccggttggtatgctgcacggatacggctgcatccgccccaactgtaccgtgttcactttcgcatgca
agtagtgctctcaattctttgttgagcttgaacttccgactcgaaagtccactcagtcggcgcttcttacttgcgtggtcttctggtccttcggggacac
cgatcgcccgtttgttttccgcttcagcctcctcgcgggtttttattcgtttgacacgaaccatatctgcgaacacgaaacagagtaacgtgacgcgtta
gacgtaacgtccaagtacgctgtatgaagtaatagtagtgtgttttgggtcttcgactactcgggtgacgccagctcccatcgaagttaacaccgatcac
tttcccacaatcaacagacgttacaatctggtgcggtattcgttgcaaaatgtgctgtcggtaagtcatggttagagcgcccgagtagtactttgttctt
ggtgcgatatccttgccccgcccaggtttaaccgaccctgattggttgtggcacggctcaactggctggccgcagcttggattgtggccaataggcaggc
gctattttgctatcgcgcagagtgagcggtgggccaaaaccccttagcacatcatttcccggcgcgatatctctcccctcttccctcctttatcctttgc
acggggctaatacgtttccaagctacgccgggcgttttcacacaccctgccagtatcctcggactatctgtgcgtcgccgtggtggtctttgcaactaac
taacatgcatacacgtagcgtaccttgtctgtgttgccaccgccgctttcgaaaagggcacaaaatgtattatgagtg