Description :
From Genome Similarity Track
Location :
Scaffold_49:874- 2018
Sequence
1144 bases(100 bases per row)
GGAGTCTTTACTGCTGTCCGCAGCGACGCATGATCTGTGTAGATCGCAAAGCGCTCCTCGCCAAGCAGATAGACACGGAACTTGACAAGAGCATACTTCA
TTGCCAGTAGCTCCTTGTCGTGAACTGGATAGTTCCGTTCTGCGGGTCTGAGTTGCCGTGACTGATACGAAACAACTCGCTCTCGACCCTCATCATCGTG
TTGCATCAATGCGCAACCGATGGCATAATCGCTCGCATCACAGACGACGTGGAACGGCTTGTCGTGATTCGGTAGAGCCAACACAGGAGCTTCACGAAGA
CTCCTCTTGACTTCTTCGAACGCCGTTTGATGGTCTTTCGACCACTTCCACTCAACGTCTTTCTTCAAGAGCTGTGTGAGGGGTTGCACTAACGCTGCAT
AATTGCGCGTGTACTTGTGCAAATAGTTGGCCAGACCCAACCATTGGCGTAGCTGTTTGACGTTCTTTGGCACAGGCCAATCGTCAATAGCTTTGACCTT
CTCCGGATCAACTCGAACACCGTTCTTGCCCACAAAACATCCGAGAACAGGGATCTCGGGGGCGAAGAACATGCACTTCTTCAAGTTTGCGTAAAGTTTG
TTTTCACGCATGACCTGGAAAACTTGACGAAGATGATCAAGATGAACATCAACATCAGATCTCCCATTCGTGGCCTTACTATGAACGAAGATATCGTCAA
AGTAACTCGGTGCAAATGTTCGTAAAGGACGAAGAACGTTCGTGACCATTCGATTGAAGGTCGCGGGTGCATTCTTCAGTCCCTGTGGCATCACTAACCA
TTCCCACAGCATACCGCTAGGGGTACTCACTGCAGTTAGTGGGACATCGTCTTTGCGCATTCGAATCTGATAGAATCAATCTTTCAGATCGATAGCACTA
AAGACGGTGCTGCCAACCATCCCATCAAGGATCATATCCTTGCGTGGAACCGGAGTCTGAGCAGGAATAGTCGCGTCGTTCAGCTTGTTGAAAGCGTGAA
CAATGCGCCATCCGCCAGTCGCCTTCTTCACACAAAAAGTGGGACTACAACGCGGAGACTTGCTCTCCCGCACATGCCCAGCCTTCGCGCGTTGCGCAAA
GAACTCGTCAATTGCCTCGACTGTCCTTGGCAACGGCCACTGTC