Description :
From Genome Similarity Track
Location :
Scaffold_43:8739- 13666
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.34Tenascin
Pytap_DAOMBR444maker-pag1_scaffold_43-fgenesh-gene-0.14Amino-acid acetyltransferase

Sequence
4927 bases(100 bases per row)
GTCCGgaGGCCGCGTCGTGGTCGTGTTCCCGACTGGTTTTGTGGTGGCACCCACTGCCTACAGCAATCCAAACAGCATCGATGGGACACTGAGTCTCAGT
GCTatCGCCAATACGGTTGTGATCACGGTAGCCACGCTCATCGCATCGGGAAGCTCGGTCGCGTTCACTCTCGACGGCATAACGAACCCTGGTGCGTGGC
ACTCACTACGGTTTACACACACCATAGACAGTGGACTCATAAGGAAAAGGACTACGAAGGTGATGGAGCAACAGGCAACTACATCATCCGGACGACGGAC
ACGACAGGCAACACGATCGAATCGACGTCGAaTATACCTGGTTCAACCATTTCCAAGACACAACTCACCGGTGTGACGTTCACGCCATCGACTGTGAGCG
CTGGGGCAGCTCTGCAACTCACGGTTGGCTTTACATCTGCCGTCAATCTTCGAGTTGGAAGCTTCATAGAGATCaTCTtCCCTGTGCTTCCTTCCAGTAA
CTTCTTTCTCTTAGGTGCAAGCATCACTGCTCGAACCGGGATCCATTCCTCTTCAGGCATAACGAGTCCGAATCCTCCGATTgTGCGGGTGACGGTTGCT
GGAGCCACAGTAACAGCAGGCACCAGTGTCGCTTTGACGATAGACGGTATGTTCAATCCTGCAGAGCAGAACATCCCAACATTCACTATTCGAACGAGTC
AGTCAAATGGAAGGATCTTCCAAGACGCCACCGGACTCGTCTTTGGAAATaTCCAACGcATTCCTCTATCGACAACTACGACTGTCATGAAAGCAACATC
ATACACTGCTGGTACTACGACCGCCTACGTATtCAGCTATTCAAATACTGCGTACATCACGACAGGTGCCAAGATCAAGATCGTCTTCCcGTCGAGCTTC
GACTTaTCAGGCGCTGGGCTTACagCTGTCACGAaCCTGCCGACGATTGCTACGACTTTtGCGTTCTTAGCACCTAGCACGgTGATtGTtACGCTTGGAA
GCGGTggcacattgccaggatccaatcgcggctttacaatctccggagtgctcaacccagggtcgtcctgtNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcagtacatatacGAATACTGCACACCAGCgTGGGgCACATACACAGTCACAGTGACGGACGCA
GCAGATCAAATCTACGAACACTCGACGACAATTCCTGGGACACCAATCGTGAAGAAACCGATGATATTCGCTCGCGTGAGGCCACTTATCAAGACGCCAA
ACACGTTGACATCTGTGAAAGTCGAGTTCTCcaCAGAGACGAcTACCCCAGTAGGTGGACGGATTGAAGTCGTCTTTCCCGATGgATTCATTAtcGGACC
TGGCGTTGCGGCATCAAACCACGTCGGAATACCCTCTGCCAGTACTACAGTCACTGTCAATGGCCAGACCATCTCGCTTGTGATTGCCGGCGCAAACATT
CCACCGACGTCGAGAATGTCGGTGGCATTTAGCGGCATCAtGACGCCAgAaTTGCTCTCGACGGGTATGTATGTCGTTCGAACGGAAGATGCGCAAGGGA
AAATTATCGAAGAAGACGACACAATCAATGGCGAAGGCTGTTCGTATCTCAATAGCTGCAGTGGACATGGAACCTGCACACTGTTTTCAAAGTTGTGTGT
TTGTGACATTGGTTGGGGAGCCCCcACTGACGTAACCTCCTACcGATCTCCCGATTGCTCAACTCGTAAGTGACCGATTACACTGGGCGTTGCATTGCTG
CTGACATACCCCGGTGTTTGTATCTATAGGTACTTGCCCTACTGGCAACTTGTGGAATGATATCCCAAGAGATGCGACTACAAGTCATGTAGATGTTGCT
GAGTGCTCTGGAATGGGGACCTGTGATCGCAACACAGGGAAGTGCTCATGCTTCCCAGGTTTTGCAGGAAACGCCTGCCAACGGAGTACGCTTCCTATAC
TGTAGCAGCCTGTATCTTGCCTGGGACTGACTGGATAGTGAAACAGTGACGTGCCCAAACAACTgCCGGGGGCGAGgtCGCTGTGTGACCATGAAGCAGC
TGGCCACTGCGaGAAaTGGGCTTCCTCTCTCTGCATCAACCACGTACACAGGGCTgAaGGTGCGATTCACGTGGAATAGATTGTTGTCCAtACgTtGACT
GATTATCGCATCGAAGGCAACGACTACGTGGGACGAAGACAGAGTGTTTGGATGCGTTTGCGACTCtGgTTGGGCAGTCGGgACGGGAGCTGGGGAGATT
CAAGTCACCGAATATTTTGGCGGTGACTGCTCATTGCGTACGTGCACATCTCGAATATGAGCGCAgaTTTGACACACTGATGCATgTGAATCCTTGTAGG
CCATTGTCCTACTGGGAaCGACCCGGAAACGTCTGCGGATGAGACCAACTGCAATGGGGTTtCAGCTCctGGTGGCTTTGCGGTGGGCGGAACTGGCAAC
ATCTGCCATGTCGAATGCTCgAaTCGCGGAATCTGCAACTATCTGAAAGGAGCCTGCCAGTGCTTTCCTGGaTACTCGGGCTTTGCTTGCCAGAACATTG
AAAGCGTGCAAAGATAAATCGAATGGACCAAAGGCGCTCGCGTAATAGTGTCTAaTGTTGCTCGAATTTAATTTATCAACTGAAGTGCAGTTCAGTGCAT
CAGGAGTAGCTCTTGCTCATCTAGCGCACGCTTGCAGCTGATATCCATGATGTAGACTTTGGATTGACGCTTcAGATCGATCTTCTCCCGCTTTGACTTG
GGAAGGTCTGACACCGATGCTTCGACGAATCCTCGCTCCATGAACCAGTGTGACGTGCGTGTCGTCATGACGAACGCTTTCTCAACACCCATGGAGCGGG
CCTTGCGGAGAAGGAAGCCGATGAGCGCGTTACCCTATGCAGAAAagAAaGCATcaGATGACCGCGTCGTCGTACCGATATCGACCATTAGTGGTAACTC
ACCTTGCCCAAGCTTCGGTACGTTGGATCTACGGCGACACAGGCAATCTCAGCAAAGTTGTTTTCATAAGGCTGCAGCGCAGCACACGCGATGATAGCGC
CATCACGTTCCACGACTGAAAAGGTGTGGACGTTGGACTCGATCTGCTCTTGATTACGAGACACGAGAATGTCTTCGTCGAGGAGTGGCTGGATCAAACG
CATGATACTGACAATGTCACTTGGCTTGGCCATGCGGACACCCTCGTACATGTGCTTGGagATCATGAGCCCTTCACCATCACGAGTGAACAGTTCCTGA
AGTAGACCACCGTCGACGTGACGGCTAACAAGATGCGAACGGGTGACACCGTTGATGCAGGCCAGGATAGACTGCTTCAGGTACAGCAAAAACTCGTCCG
AGACGTCTGGGTCGTTCCGTGCAAGTTCCACATACTGCTGAGCCTGCTGGATAACGAGCGCTTGCACCGTTTGGTTTGTTCGAGAGTCGATCATTTCTTC
ACCTTCGTGCAGGAAAATGAGCTTGTCACTGGCAAGCTGAATAGCACACTTGGCTGCGACTTGCTCGGACATGCagTTGAAGACTTCACCACTTGGACTG
TAGCCGATGCTTGAGATGAGCACAATATCTCCATTGTCGAGCGCTTCGCGAACTTTGGGTACATTGAGCCGACGCATTTCGCCTGTGTTCTTAAAGTCCA
CGCCTCCACGTACACCAACAGGCTGCGCAGTGATAAAGTTACCAGATGAAACATTGATCGCGCGTGCACGGCCCGGGGTATTCGCAATGCCTCGGCCGAG
GAAGCTTTCGATCTGGAAACGCACCGAACCAGCGGCGTCCATGGCACAaCGCAGATCTTCCGTGCTCGTGATGCGAACGCCACTGTCAAATCGCTGTGGC
AGCTTCCGCAATTCGAGCTGCGCATTCAACTGAGGTCGTGAGCCAGCGACAAGCACGAGCTTAATGCCGAAGGTGTTGAGCAGCGCAATGTCCTGCATCA
CGGCACTGAaCACGTTGGATTCCACGAGCTGTCCGGGgATGTGGATCACCATGGTCGTGCCGCGGTGGAAGTTGATATAGGGCGACATCATGCGGAACAT
CTCCGTGAACGAGTTGGGTCCAGGCCTGGCGTCTCGCTGAGCTGGTGTCTTGACCCTAAGGCACTCGGGCGGCACGACcGGCAGGAAGTCGGCGAAGTCA
CCAGTCGCCGACGCGCTGGGCTCATCTGGCAGCCAGGAGGCGGCGCCACGATGGAACGCGCGCGCTGCTATCGGCGCTGCATaCGCGTGGCTGCCGACGG
CTGCGCGACGCAGCTGCAGAGCGGCATGCTTCCTCCACATCAAGTCCGTTGCTCGAGCGGCAATGATGCTGCAGGACGGAGGGCGGAGCAGGCGCCGGGA
CATGATGCCGAGGTTGGCTCGGGAGATGAAACCGCTCTCGGTGATGGGGgAGTATTAGATGTCACAAGTTATGAAGAACAGAcgATAGGTAAGAATTTGT
AGCATTTGATGCAGAATAGAACGAAGGTATTcaGTTAAAGAGGTGTAACCTGTCgTTTCACGTGACCACAAGAATATTTGCACCTGAATCGAGCAACTTG
AAGCATcATTCCAAGGGAAaCGTTGCAAATTAGGAGGTGTACACTACGCTTTCGtCAGCCTGGCTCAGTCCATGTTGAACTCGGGCCACTGGTGGGGAGC
GCCCGCACCATTTGACGAGCATGTGCATGCCATGCCGTCAGAAaTACGgTGTCGCATTCTGCATAATGCACTGGaCAGCCATCGATTCCAGCGCTCAGAT
GCGTCCAGCAACTCTTTtCTtGGTGTG