Description :
From Genome Similarity Track
Location :
Scaffold_107:87364- 90123
Transcript NameFunction/comments
Phyci_238765Hypothetical protein

Sequence
2759 bases(100 bases per row)
ccgAACCGCCGCCCTTGAGCATGTTGCCGCCCTTGCGCACCTGCTGGTTGAACGTGGCGTTCTGCTCCTCCATCCAGCGGCGGATCTCGCGCTGCTTCTC
CTCCTTGGCAGCGAGCCGCGCCTCCTCCTCCTTCTGCTTCTCGCGATGGATGAACTCGGCGTCGCGCCGCAGCTCGCGGGCCGCGCCCTTGCGTGCGCGC
TTGACCTGGCGCTGCAGCTGCTTGAGCTGCGCCGTGTCCTTGGGCGCCGTCTTGTCCTTGCGGACCGTGTAGTTCTCGTCGAACAGCGGCGCGAACGTCG
GCAGTGTCGTCGGCGCGAAGCTCTGCAGGCGCAGCGGACGACGCGCGCCCCAGCACGACTCGAGGCGCTTGTGTAGCTTGGAGATCACGGCATTCACCTC
CGAGACCTTGGAATCCTCCAGCTGACTCACCAGCGCGTGCAGCAGCAAGTACAGCGGGTAGAACAGCTCGTCGAACGACGGCAGCGACGCGTACTGGGCC
GACGCGGCATCCAGCAGAGCCAGCAGTGAGCTCAACACTTGAGCGCCGCTGCAGGACGAGCTGCCAGCCAGCGACAGGCGCGGCAGGGCAGGCATCTTCT
TCTTCTCCTCGGAGTGGGCAGCCACCCACTCGAGCAGGTCACGACGCAGCCAGTGGACCGAGGAGGACTTGCAGTCGTCATGCTCTTCATCAGCACCCGA
CGTCACGAACGCGCGGAGGATGCGAGTCAGGAACGTCACCACCTCTGGCATGAAGCGCTCCTTGGAACGCGTCATGTCCAGCGACAACGACGCTGCGAAC
AGCGCCTGTGTGGCCGCCTGCGGAGAGCTCACAGCACCACGAGCCAAGCTCTCGCCCAGAAGCGTCTCCATGGGAGACACCACGTTGTGCCGCAAGTCGG
AGGTCGGGAAAATGGAGGTCAGTGCCTTGAACAGAAGCAGCTCCGGCAGCGTGGGCCACGCCGAGGTCGACGCACGCTTGTGCAACCGCTTGAAGAGCTG
AGCCAGAAGCTCACGCACAACGACACCGGCAGTGTCACCCATCTGCTGAGCCAGCGAGTACATATTCCTCGCCAGCGAGTCCAGCTGTAGAAAACAACAA
ACAACATTAGTACTCGCTGTAAGCAATGCACATAGCTGCAGGCAGAAGTAAATCAACGTACGTCTTCCTTGTGTGCTGCGTAACGCGCCGCGAAGATAAG
GAACTGGCGCACCATCACGGCGAAGAAGCGCTTCATCTTGTTCTTGTTCTCCACGCTCAGGCGCGGGTTGTAGAATGTGACAATGCGGTCCAAGATGAGC
CCGCGCTTCTCCGGGGAGTTGCGCGCGTGCTCCTTGAAGAGCGCCGCGAGCTCCTCAGGGGACTCCGGGCACTCGAACACGAACGGCAGCTCGGCGGCAG
cctcctcggcatcctgcttcctcttttgcttctcagtctcttcgtcactttcgtctgcgtcttcctcctcttcctcctccttctctttcttcaccttggg
ttcgtcttcgtcgtccgactccgcttccGAGTCGGGctcctcctcctcctcctcgctctcctcctggtcctcctcattctcgtcgccatcctccgcctcc
acatcggcctcttcctcctccGCGTCAGCATTAAAGCGAGCATCGACAGCGTATCCATCCGTCAAGTCGTCATCCGTGGGGGGCATGATGATGAGCTTGG
GCGCCTTGTCCTTGGCTTTCTTCTTGCCCTTCTTGCCCTTCCGCTTGCCCTCGTCCTCGCTGTCACTGTCGTCCTCGTCAGCGCCGTGCATGCGCGCGAC
GCGCTTCTTCTCCAGCGCCGCAAGACGGTCGCGCTCCTTGGCGGCCGCCTCCTCGGGCGACATCCTGCGCTCCGTGGCCTTGGCCTTGGCCTCGAAGGCG
AACTCCCTCGTGAGCTTGTCGAAGTCATCCATGGGCTCCTTGGGCAGCAGCTCCTTGCCGTTGGCGCGCGTGGGGCGGAACTCCAGCAGGCCCTTCAGGT
CGGCGAAGCCCTCGTCGAGCTTGTCCGTGGCGTCCTCCTGCGACGTCTTGTTCTTCTGGCGCTCGGCCTTGAACATCTTGGCCTTCATCATGACCTCCTG
CATCACCTCCTTGTGGCTCTTCCTCTTGCCGTCCTCCGCCCGCGTCTCGGGGGCGTCGGCGTCTCCCCTGCCTCCTCCAAAGTGGAGCTGGTTGACAATG
TCCCTGTCCATCCTGCGGCTCTCCTCCGAGTCGTCCTCGTCGTCCAGGGGGCCGTCGGCGTTCAGTCGGTCGTAGTCGTCGGCCGTGATCTTGGCGCCCT
TGTGCGTCAGGAAGAGCGCGTCGTCGTCGTCGTCGCCCTCCTGCTCCGAGTCCGAGTCGTGCAGCGCGAAGGCCGCGGCGTTGCGCAGCTTGCGCTTGCG
CTCCGTCTGGAAGCGCGCCATCATCTTGTCCTCCACGGACAGCGTCGGGTCCTGCTCGCCCAGCCGCCGGTCCTTGAACACGTTGCTGCGGTGGCGCGCC
TGGAACTCGGCGCCCAGCGTCTTGCGGCGCTTGCGCTCGGCCTCGGCTCGCGCCGCCGCCACGTTGCGGCCCGCGCCCTTGACGCGGCGCCCGAGCACCT
CGTGCTTCTGCTGGCTGGCGTTGCCCCGCACGTCGAACGGGTTGGCGCCGCGCGAGCTGCTGGCGCGCACGAAGCCGCGCTTCTGCTGCGGCTGCTGCTT
CTTGGCGCCCGCCTTCTTGCCGCCGCCCTTCTTGAACGCCATGCTGCCGTGGACGCTGC