Description :
From Genome Similarity Track
Location :
Scaffold_22:87339- 95529
Transcript NameFunction/comments
Physo_132671reverse transcriptase
Physo_132672hypothetical protein

Sequence
8190 bases(100 bases per row)
ACCTTGGTGTAAACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGCATAGTATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAAGTTA
AACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACACCTGGTAGCACTTCGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCA
ACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATTCTGAAGGAGCAACGCGATGTCGCTGCTACTACCGCGGTGTCGTCCGG
GACGACACCACGCGCGCAATCGCTGAAGCTCAATGTAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCA
TTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTATTGGCGGACGTGCAAGAAGTTGGGTGTATGGACGCCGACTCTC
GGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTC
GACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGTTCAGGGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATCGACGAGGCGACCAAGG
TCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTATTGCAATGCA
GGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGTATGCACATGCGCCGAGGCAACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTC
TCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCC
CCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGTACCGTCGCAAACAAAAAACGCGGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAG
TTCCGCGTATCGACCTTGGACACGCGACACTGAGGACTGCAGCTCCCAGTGAGGTTCACCCTCACTGCAAGAACCACGATGACAAGCCTGACCTTGTCAT
CCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTT
GACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTCA
CGTATGAAGATCAAGAGTTTGTCGAGACGTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCC
GGTCATCGATCGGGAGAAGCGCACTCTCGTGCGCTTCGGTCTCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCG
CGCGACTCCCCACTCGAGACAGCGCCTAATACCGCTGTCCCGGAGCGTCCTGGGCGCGCGAGCACGTGCGCAAGAGCAGCTAGCGTCGGCGTTGCCGCCG
ACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGACTCAAGGTGCACGGATGACGCAGGCGA
GTCACACGCGTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGTTTTGGCCAATAATAAGAGACAAGGTGACGAAACGCCGTCGACTCCGGGAGTC
GATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCTGACGCACCCTCCGTAATGGAGGTCTCCGCCAATGGTTGGCGTCGAGGTATTGAAGTCGCAT
CGACTCCGGGAGTCGATAGCTTGGACGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGTCAATAACAGGCGTCGAGG
TGAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTTCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGG
CTGCACGACGAAGCGCCGGGCGAACAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTATTAAAGAAGAACACCCGTCCACGGCTG
GGCCTGGACGAGGTCAAGAATCAAGCGGATCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTGTCGGCCTTGGGCCGAGAC
GCTACAAGGAATGTCTGCCGGGCAGACGGAGGCGGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTATCTGTGCCGGGTTCCGGTACAGGGAG
ATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGTGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGACGGACGCATCG
AGCAAATATGAATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAAAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCT
CAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTT
CCGGAAGAGATTCCTGCGGAGCTTCCGCAGGATAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCAC
TACCTCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGTAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTT
CTGTGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGAT
GTTATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCA
CGGCTGTGAGCACGCCGAGCGGCATGTTCTGGGAGTGGCTAGTCATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGGCGCACTT
GTTGCGCGACTTCGCACCGAGGTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGG
AAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGAGTGAGATACCTGTGCTCGGGTGTCTCGTTGGGA
AGAACGGTGCCCGCCCTGGCCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCAC
GTACTTGTGCAAGTACGTGAAGGACTATGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGCCGCCGAGTGGGTTTGGACTGCTGAGTTTCAG
CAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCTATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGCCT
TCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACA
TGACAAGGAACTCCTTGCCATGAAGTATGCACGTGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACAGACCACGCATCACTG
CGGACGGCTGTGAAGTTGCCGCACATCTCGCAACGGATGGCAAGATGGGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGG
AAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCA
ACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCGTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTC
AGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTGTTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGT
CGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTC
ACGCGAGACTTCTACTGGGCCCACCAGTACAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGG
CTCCCTTGCAGTCACTACCAACTCCACGATAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCAGTCTTCCCACGGACAGCCAGGGGAACACGGGCGT
TGTGGTCTTCGTTGACCGCTTCAGCAAGATGGTTCATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATGGTG
TTCAAACACCATGGCATGCCGATCGACGGATCGGGACCCGCGCTTGACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATG
TCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGCGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGA
GCGAGTGCCTGTCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCT
CCCGAGTCTACTCGGGATGGTGGCTCTTTCCTTAAGTGAGGGAGGATCTATGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCA
GCCGCGACTACGCGCAAGAAGAAGAAGAAGCACGCGTGTGTGCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGAACGGGTCTGTGCAGGGCA
CAGACACCGCGAAGACGAGCGCAGAGGCCGGGCCTACTGCTGGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATTAACTTCGTGCAGCGCAGACAAGC
CATCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACTGACAGAAGCTGAACGCAGACAATGTTGATAGGGCAGCACTAATGAATTCAAGAAGG
GTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCCGTTTCCGACTTCGGGGCAAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGT
ATTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGTATGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCAC
GAGCCACCTAGCTCGGCTGGCCCGAAACGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGCACGACGCGACCTCC
CACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTGAGCAACTTGAGCTCGCAGGGTCGCCCTCTCCTGCTTCAGAGCGGCGAACTCACGGCTCTGA
AGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCTAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATC
CGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCTTGTATCCCGAAACCGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAG
AGGGTTTCCGCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCG
ACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGCTCCTCACGTGCCAAGAACTTGGCACGGAGATCCTTGAG
ACTCGCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACA
GCGCATGGAATACCAGCGTCCACAGAAGATCTGTGGAGCTGCTCCAGCCGCCCGCGCGTCGAGAATGTCTCGAAGCGCTCACGGGTATGCTTAACCCGCT
CGCGGTAAGCAGCCGGTTTCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTGCGAGAAGAGGTCTT
CTTGCTGGAGAAGTACCGGAGCTCGTGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTTACGGATCAAAGTGCTGCTCCTCCGCAACAACATCG
TCGTGGATACCGCTGGATACGTACAGCGGGATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGC
GCGCTGCCTGAGCAGCGCGCGGAGAGCTTGAAGGCGCCACCTCACGCGGGGAGCTTAAAGCCGCAGCAGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGA
ACGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTG
CTAGAAGAGGCCTCGCCCTCTTCCATCTCCACGTCGTCGTCTTCGTAGTCAACGGCGTCGTTGACTACAGAGGAACCTTCGAGGACAATCTCCGACTGGG
TTGTCCCCGACGCGACCTTTGCAGCGAGCGTATCGCGCTTTGCCTGCTGGCGCTCATGGTACTGAGGAACAGAGAGGTTACCCTCTGTTGTGGCGGCGGT
CTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGAGAGTTCTTTCTCCCAACGTGAAGCATTGACGAATGGTCAATTTCCTGATTGACGTGCCGTGAC
TCGGCGCGTCTAACCTTGAGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTGTAACAGACACGACGTCTGTTAGAGTT
TCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGATGGTCCATAGAGACTTAGGATTCCTATTGGC
TGAGAGCAGCATCTCTTAGCCAACGAGCGACATGCATAGTATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGG
AAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTAT
AATTAACTCTAAGTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACA