Description :
From Genome Similarity Track
Location :
Scaffold_1:87333- 90074
Transcript NameFunction/comments
Physo_127031hypothetical protein
Physo_127032PREDICTED: similar to Hsp70/Hsp90 organizing protein homolog CG2720-PA isoform 1

Sequence
2741 bases(100 bases per row)
CAAATCGCAGCGTGTCATTATCCTTCTTCATTGGCTAAAACCCCACCCAAATACCAGCCAATCACGATCCATTGTGTATGTGGCCAAGCCGGCTCCGCCG
CACATTCAAATCTTCCAGGAAGCGCATCATGTTCGCCCGAGTCGCTCGCGCCGCCACCCTCTCCGCCACCCGCCGCGCGCCGTCCGTGGCGCTGCGTGCG
CTGCAGACCCGCGAGAAGTCGTCGCTGGCGTCGGTGCTCAAGGTGCGGGCTCAAAACGCTCAAAACTGCGCTCAGGATGCTCTAAAAAGTAGCTCTCCAA
CCCTCTAAAACGTACCTTTGTGATCCTAACTCCACTTCAGCGCGAGCTCGACGAGGAGAAGGCCAACTGCTTCGAGGAGCCCGAGATGGAGGAGCTGCGG
CTCAAGGTGGAGTCGGTCTTCAAGCTGCAGGAGACGCCCGGCTGCATGGACATCGTGCTGAACGGCACCATGGGCGACGACTCGATCAAGATCAAGTTCA
ACGCCCAGGACACCGTGGAGCTCGAGGACGACGAGGAGTACGGTGACGACTACGACGAGGAGGAGGAGCAGCAGGAGGTGGACGAGGAGGAGGACGAGGA
GGAGGAGGACGAGCTCCCCGGCGTCCGCTTCACGGCCGACATCACGCGCGACAACCAGGGCCTGCAATTTGACTGCGTGGCCAGCAGCAACGTGACGGTG
GAGCGCGTGCGCTACCTGGCCGACTTCGCCAAGGAGGCCGAGGACGAGACGCTGTACTTCGGCCCCAACTTCATCGACCTGGAGCTCGACGTGCAGGACC
ACTTCTACCGCTACCTGGCGGACCGCAAGATCGACGACGAGCTGGCCCAGTTCATCACGCAGTTCGCCGACCTCAAGGAGCAGCGCGAGTACACGGCCTT
CCTCGAGGACGCCGAGACCTTCGTCAAGCACTAAGCCTACCGTTCGGACCAACCCACTCGCTATGCATAGTCTGCTTGAGGCCTAGGACTCGACCCCGCA
CAAAATAAACAGTTGTTAGAGCCTCACTGCCTTGGCATTTAGTCGCAGACTGCGCCTATTGCTGCTGCTGTCTAACCTTGCATCCGGGACATGACGCTCT
GCATGAGCTGCGAGACCTTGGGGTTCGACATGTGGCGCATGGCGGCGGACGGGCCCTCGCTGTCCACGTCGCGGAAGAAGTCCTGCAGGTCCGGGTCCGA
CCGCGCCGCCACGAGCTCGGGGCTGTTCATGAGGCCGCTCATGTCGGGAATGCCGCCAGCTCCAGCGCCAGCTCCAGGAGCAGCAGCACCGGCGCCGCCG
CCGAGGCCACCCATGAGGTTGCTGAGCATGCTGGGGTCCTGCATCATATTCTGCGCCATCTGCATCATCTGCGGGTTCTGCATCATGCTCTGGGCCATCT
GCATCATCTGCGGGTTGTTCATGAGGTCGGCCAGGCCGCCGCCACCGCCGCCACCAAGCATGCTGGCCAGGTTAGACAGGTCCGGCATGCCGCCAGCACC
AGCAGCAGGCGTCGAGGCCGAAGCCGCGGGCGTCGCCTGAACCTGACGACGCTTGCGCTCCGCCTCAGCGAGGCCGTCGCGGCAGGCAGCGTTGCTGCTG
TCCACCTCCAGTCCGCGACGGAACGTGTCGATAGCGCCGTCGAAGTCCTTGAGCTGCACCTGGGCGCTGCCCATACGCGAGTACGCCTTGACGTACGACG
GCTTGAGCGCGATCGACTTCTCGCAGTGGTCGATCACCTCCGAGTACTTGCCCAGGTAAGTGAGCGCGGCCGCCAGGTTCGAGTGGTAGATGTGGGACGA
TGGGCCGTTGGACGAGAGCTGCAGCGCCTCGCGGTAGAGCTTGGCGGCTCCCTCGTAGTCCTGGCGGCTCAGTGCGGCGTTGCCCTGCGCCTTCACCTCC
TCGGCCTTGGCCTCCTTCTCCTCCTTGGACAGCTCCGGCTTGACGTCGCCGAATTTCTCCTTGAACTTGGCCAGCGCCTTAGTCGTGCGCACCGCGTGCT
CACTGGAGCCGGGGGCCGCGCCCTTGAAGAAGCTCTTGGCCTCCAGCTTGGCCACCCACTTCTTCCACAGCTCCGGGTCTGCAGCAACAGGTTAAAACAG
CACCAGTCAGCCCCTCACAGTCTATAATATATACAGTGTACTATACTGCAGCCAACGCACGCTTCTGGACGACGGGGTCCTCGTCCACCGCCGCCTCGTG
GGCCTCGCCGGGCGTGCCCGTCTCCAGGTTGAGCGCCTTGAGCCCCGCCGCGAAGATCTCGTCGAACGAGGCCTCGCCGTTCACCGCCAGCTGGCGCTTC
TGCTCGGCGTCGCGCACGTCCACGCCGAAGGCCTCGCTAAGATAAATAAAATAAAGAATATAATAAAACATAGTATAATACGTGAGTTCGAGAGATCAAT
ATCGACCAGTTGCGCGGCTTGTAGGGCGAGTTAGAGCGTGCAACTTACGTGAGGCGGGACAGCGCGGCGTCCACTTCTTGGGCGTCCACGCCCTCGCGCG
TCTTGAGCGCGTCCACCCACGCCAGCGCGTTGAACAGCGTCGCCTTGCTGGTCTCGTCCATCTTGCGCCACTACAGTCAATGTGAATCAAATTCTCCCCC
GCGGTTCGAACTTCGAAGGCCAAAAAACTCGTTGGGCTCGCTGATTGGCCAAAAGCGTATCCGGTTGAAAACCACCAATCACAAACCCGCGTATCTAAAA
GATCGGAGCACTTCAACTACAGAAGACATGGCTACTTTTGT