Description :
From Genome Similarity Track
Location :
Scaffold_2:87300- 89857
Sequence
2557 bases(100 bases per row)
GCCACGAGGCGGCGAAGCGCTTCCCACTCCACGCGAGTGAGATGGGGGAATGCAGCATGCTCCAGGGTCGCCCTGGAGATCTGGACTTGGCTCATCGTAG
ACTTGGCCGTTGAAAGGACTACTAAAGTGCTACCAGGTGTAACGGGGAAAGAGATACCGTTACTAGCTTACACTATAGTGCGGAGGAAGCTCGCAATAAT
AAAACCAAGTCTTAGGTTTGTGTCAAATTCAACTCTGATTTATTTAGGACCAGGGCGGCTACCCCTGGCCTCGTGTGAAACACTCAAACACATGTCTCTA
TCTGATTGGTCAATATGTGAGTCTAGCTCCTCACTATCAACCAATCAGATGATGACACTTTGCAACACGCTACCCGTGTGCCACTTTACCTACTTATGTA
GTAACTAAAGAAATATCTACCTACTTATGTAATTGGAGTTGGGCCCATTACATCACCCTCCTCTCTAAGTTGCGCTTACGCAACATAAGCGCACGGAACA
CATTTGAAGAAAACTCGAAAACCCAACGGAGCGAAGATGGCCGAGGACAACACGACGCAGTCAACGGGCGTTAGCACCAGCGCGACGCTGGTGACAGCAG
CAATCATCGACGCACTAACGGCGGCGGTAACCCAGACAGCCGAGACACCGGCGGAGCCGACAGTCACGAGGATCAGTGCCGGAAGCACGCGGTCGCGCGT
GATGGACGACGCCCTGGTTCCCTAGGACCTGTACGACTTGTCAGGAGCGGAGAATCCGGATACGCTAGACACTATGAAGAACCACTTTCGTCGCTTCCGC
GCGACGCGGAAGAAATACATTGAAGGCGCTGATCGTGAGGGACTTCGTCGCTCTTGGTGTGCCTTCATCCGGCGATGGAACCGGATGTCGCGTGCTGGAG
AAAGCTTTGTCGACTGGTTGGCGTATCGCGAGGAGATCCTCGCGGATCATTCGATTGGAGAGCTGCGCGTGAATGTCTGCAACAACGCGTGGGATTTGGA
TCGACTCTGCTTCGTGCACGTGAGAGAGGGGTGCGAGTCCTGTGGTACTTCAACCCGTCCGACTCAACGCGAATGGAGGGAACATCTCGCTGAGCGGCCA
CTCAGCGGCGAGGAGTCGGGATGGATCGGAAAGTACGAGCACACCCTGTCCAGTATGGATCAGGCGGCTAATCGCGGCGGCTCACGCCGGCGTTGCACGC
GTCGGAGCGCGGCGGCGTTGTCGCCTCCTCGTGCGGGTCGTTCTCGTGGCCGTTCTCGATCTCGTTCGCGGTCTCCGCGGGGTGACCCGCAAAATTCTTC
TTCTCAAGCAGCATGGTCTCATACTCGTGGACCACGTTCGGAACGTCGCGGAGAAGGTTGGCGCGGGGCTCCCACGTATTATGTTCTGGGGAATAACCGA
GCCAACGTACCAAGTAGCGGCGCGCGGTCGGAACCGCGCGAGGAACACGACTACGGACGTTTCGTTGAGCGGTCGCGCTGTGGGGATCTTCGTGGTCAAC
GATACGCTCCACAATCCAGCGCGCATCACCCACCGAGTCAATTATCGGTGGTGGGCCTTCACGATGATACGGCGTACGCCCTGTACGTTCAGGGCGAGGT
GGAGGCAGCTTCGAACCGCGCGTTGGACGCTCAGGCTGGGGCTGAGCACTCCGAGCTACTTACGAGCATGACTCGACGTACTTCAGTATATTCGAGCATC
TCCACTCTCCCGCGTCACCCTAGGAGATCTTTCCCGCTCTGTACGAACCTATATTAATCGATATCGTCTCAAAGATGAGCTGCTGACGTACAGCATCAAT
AACGTCGATGTCCCACGTGTCGTTGTCCCTAACGCCCCGGTCTGCGGACACGAATTATCCATGCGTTTCGTGATGCCCCGCTGGGCGCTCATCTCGGTCG
CGAGAATACGTTTGCCGCTGTGTCACGCGACTTTTATTGGCCCCACCTGTATAAATGGGTACGTAAGTGGGTGCGCACCTGCGAGATCTGCCAGTGCGTA
AAACCTACTTCGTCGTCGCAGGCTCCCCTGCGGCCTCTACCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATGGACTTCATCTTCGGGCTCCCACCCG
ATGCTAAAGGACGTTCAGGTGTCCTGGTGCTTGTCGACCGCTTCAGCAAGATGGTCCACCTGATTCCGGTGTCGGATTCGATCACCGCGGCAGATACTGC
GGTGCACTTCATCAATGCGGTCTTCCGCCATCTTGGTCTTCCTAAAATCCAGCGTCTCCGACCGCGACCCGCGCTTCACGTCGGCCTTCTGGTCAAAGCT
CGTGGTGTTACTGGGCTCGAGCTGTCCATGTCCACGGCAGCCCATTCAGAAACGGACGGCCGGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTC
GAAGATACGTGACGGACGTTCTCCAGCTGGAGCTCGTTTCTTGCTTCTGGCCGAGTTTGCCACTTGCAACGCGGTACACCGCGGCGGACTTGGGCTGGAT
GCCCTTCTTCATTTAGACACGCGCGACAACCCCGGTGTTCCCTGCTCCTCCTGTGTG