Description :
From Genome Similarity Track
Location :
Scaffold_969:873- 3760
Transcript NameFunction/comments
Phyke_g11361conserved hypothetical protein
Phyke_g11362hypothetical protein PHYSODRAFT_300538

Sequence
2887 bases(100 bases per row)
TCAATCCAACTTCTAAGATATATTCGATCCGCACGGACTGCCGTAGCACGAGTATTTGACACACGTGTTTGAACATCCGCTTGCAAAACAAGCAAGACGA
TGCTCAAGCGCAACATCAACTATAGCAACACCGTACGACCCTCAGCAACTACATTGCCGTTCATGTTTCCTACCTATCAACGCCAATCTACTCAACCTGC
TCGACCGATCGCTTTGGGCATCTTTTTAGTGCGAGCGTCCTCGACTTCCTTCGTTTTATAATAATGCGGGGCAAGTTCCATCAGCCATTCGGACTTGATG
GGAAGCACGTTGCGCATATACTCCTTTGTCGTGAACGCAAGCTCGTGATAGACAACCCAACGTGGAACTTCTTCAAGCTTGACGAGACATGAACTCGGGT
GGATATGCACAGAttgcgccttcttcaccgttTTGTAGTGCCCTGAGTTGTCCAGCTTGGCCGTGTTGTAAAAGTAGCCGGCACAAATCGCTTTCCGAAT
AGGCTCGTGTTCACTGCGGTTGCTCGTGCGCTCGAGCTCAACGCGATCACAAAGACCCTCCAACTGCTCGCGCACATCACGTGCAGTCTTAAGTGAGCGC
ATGATAACGAAGTTCTCATAGGTCCACTGCGTGGAGTAATTCGTCTCGACCCACTGATTGTACACGTTCATCAGCGTGATgtgatcgccaccaccaccac
gcgcAAAGTTGATTCTAGCGTTGTCAGCGTGAACTGCCTTGTCCTTCGGGCGGTAAAAGATCGAGTTGTTCACACTCAGCATGGCGCAAACCGTCATCAC
TTCCTCAGTGCATCCGAACTTCTCCGAGGCAAGCAGTGCCTTGGACATCATTGGATCCAACGGAAACTCGGCCATACGGCGCCCCATTTTGGTTAGTTCG
CCCATACCATTCAGTGCGCCAAGTGCGTACAGCTGCTCGAGTGAGCGGATTAGCGCCTTCTCCGGTGGTGGGTCCATAAAGTCAAAGTGGAGCAAATCGT
TGATTCCAAGTGATTTCATGAGTAGCACAACACTTGCAAGATTTGTGCGTTGGATCTCCGGTACGGTGTTCTCATCGAGCTCATTTTTGTACGACCACGC
CGTGTACAGACGGAAACATTTTCCTGGAGCTGTGCGGCCAGCTCGACCGGCACGTTGGTTAGCCATGGCCTGAGAGACCGGCGCTACCAACAGCGATTCC
ATGCCGGTCTGTGCGTTGTAATTGGTCTGTTTGCAAAACCCAGTGTCGATCACGAAGCAGATACCTGCGATCGTCAGCGATGTCTCTGCGATATTTGTAC
TCAACACAACTTTGCGAGCTCCCTCAGGCGTGGGCTCAAACACCTGGGCCTGGCGCTCTGATGGCAGAGTCGCGTAAATCGGTCGAATGAGCAGCTCGCG
TATCCGAGAACCAAGCCCACGAgtacgctgcagcagtatttcTTCGGCCGcctcgatttcttcttggcctgtAAAGAACACGAGAATATCACCAAGGGGT
TGTGTAATGTGGATCTGCAACACCGTGACAATAGCTGCATCCAGGTAGTCGGCCTCAGGAGCCTTCGTATACAGAATATCCACGGGGTACATGCGACCGG
GGATCTTGAAAATCGGGGCATCATCAAAGTACGCGCTGAATTTGGTCGCATCCAGCGTCGCGCTAGCCACGATGATCTTAATGTCATCTCTGAAGCGCGC
AATATCCTTGATGAGGCCGAACAAAATATCCGTACTCAGAGTACGttcatgcgcttcatcaaTGATCATGACGCTATAGGACTTGAGATCTGGCTCAGTC
AGGAATTCACGCAGAAGCATACCATCCGTCATATACTTGATCACAGTTTTGTCACTTGTACAGTCCTCAAAACGAATGGAGTAGCCCACTTCGTTACCAA
GCTTCACGTCCATCTCCTGGGCCACACGGGCCGCTACACTCATCGCAGCGACACGTCGCGGTTGCGTGCAACCGATCTTCCCCAACTCCGAATATCCGAC
CTCATGCAGGTACTGCGGAATCTGCGTCGTCTTGCCCGATCCAGTCTCCCCTTCAATGATGATAACGGGGTAGTTTCTAATAGCCTCCAACAGCGATTCA
CGATAGGGATACACTGGCAGCTGCTTGCGTCCTTCCTGGATACTTACGTTCTTGGCCCGttccatcttcatcttggcttccttcacgtcttcttcactga
CGTGATGGCCAGACAGCATCTGCTGGGAGATGAAGTCGATCTGGTCGTCAAAGACGAactcgtcctcctcctctatCACCTTGTGTTTGTGTTTATCCTT
GGCTCCAAATCGACTCGTAGCCATCTTGACTTGCGTCTCCTCCCAGACTTCTTGCTCTGTACGGAAcacttcctcttcttcatacCTGTCCGTCAACAAC
TCTTCCTTCTTCCTCACTCTATTGCCCTCATCATCCACTTCTTCATAAGAGTCTGGGATCTGATACCCTTCCACCTCATCTTTCTTTGCTCGAGCTTTAG
CAGTCTCTAAGATCCGACGATTCAGCGTcatctgctcctgctccttcttACTGCGCTTGGCATCGTCAAACAACACGTCCTCGTCTTTTAACTGGAACTC
CAGtaactccagctccttctcctctctcttcttcaagtATTCCTGTCTTGAAAACTCTCTGAGTGTCGTCAGCTTCTCACTAAGAGCGTCCTTCCCTTCT
TGTACAGCTCCACGCTTAGCAAGTTGTTTGATCTCTTCGGCGCTCAGTCCTGAAGCCTCGACGccctccagctcctccgccTTCCGCTTGCGTTTCGTCC
TGTCTTCGTCCCGTTGTCTCAACCGCTCAGCAAAGGCGTCCCGCTCCTTGCGGTCGCGTAATCGCTCTTGTTCCTCCCCAGTGAGGG