Description :
From Genome Similarity Track
Location :
Scaffold_160:87298- 88825
Transcript NameFunction/comments
Physo_143978hypothetical protein
Physo_143979hypothetical protein

Sequence
1527 bases(100 bases per row)
TGCAGCGAAGCCCTCGGTAGAGAAGCCCAGTTGCGAACGCTGCTCTTCTTGGGTCGGGCGTCTGCCTCCAAAGGATGACATTCGGTCGTTTCCACCGGAC
GACTGGGTCGTCGACGTGTTCGCGTCTTCGGGGAAGTCGAACGGTGTCCGCGGCGTGGACCCCTTCGGGCTGAAAGGGTCGAAGTCGACGATAGTAGACT
TCAGATCACGGGTTTGGTGCGATGGCGCAGGTGCTAGCGTTGGCTCGGGAGCGCGGATACCAGCGAAGTTGGGCGACGTGGCGAACGGATCCGCAGGCTT
CATGACGTTCTTGATGTTGTCGTACATGATCGGCTCGCCGCCGTAGGTCGGCATCGGCATGAGCTTGGTGGGGGCATTGCTGACATTCTGCTGATACTGG
GGCTGCATCATCATGACCGGGGCGGGGGCGGGCATTTGCTGCTGCTGGTACGGGTTGTACGTTGCGAACTGCTGGCCTCCACCACCCAAGCCTCCAAAGG
CCGAAGGACCTTGCTGGGTCATGAAGTTGGCGCCATTCGGGTACATCGGCTGCATCGGTTGCTGCTGCTGCTGAGGCATCATCATGCTGTTTCCACCGGC
CATCGGGTTCACACTCGCGAAATTGTCGAAAGGGTTGGCCATCGGTGGATACGCCGGTCTAGGAGCCGTGGAGAAGTTTGATGATGAGGCACCGCTTTGC
GAGGACGATCCAGGCTTCTGCATGGGGTCTAGCATTGCAAACGGGTCGCTCATGTTGGTGCGGTGGGGAAAAGTCTGCTAGAACCGGACGCTTGCACAGC
TGCGAGAAAGCAGGAAATGACCGCGCACCTTCGAGGTTCTTGGTGGGCACTAACTACAACATCGCAGAAACCGCTTTCGTATATATAGCGGAGGTCGTGG
GACGGCGTGAATGGTGCAGCATTTCACGCGCGCAACGGACTCAAGACGCAGAATTAGCGCTGGAATTCGCGGCAAAACGGACGCGCGTTGAAGCGTGGAC
GTTGAGAGATGCGAATCCTGCAGCCCAAAGCGCAGGAGTAATCCAAAGAGTGATTGATGAATGATAAATTTATTCAACGTAGGTTGAGTTTCGAGGTGTG
CAGGTTAGATAATGTGCAGACCTGGTTGTAATCCGCATCTTACCAGAAGATGTCGTTCGAGGTCGAGGCCGGGTTTGCAGGAGGGTTGGTTGGGGCTGCG
GCGAAGATATCGTCGACCGGAGCCAGTGACGCACTGCCCGCTACGAAGTCGTCGACGGTAGTAGGCTCGCTAGTCACCGACGTTGGGGCAGAATCTCCTC
CTGCAACACTCTTCAGTGAGATCTTGGCCGTGTGGCCTGTGCCAGCGAAAGCTCCGGCGTTGAACCCGAGGTTCTTGCGCGCGGCCTCCTGAGTCGGTCG
CTTTCCGTGTGCAAGTCGGCTTGCAAGAGCGCTGGACTTGCTGCCCGAAGAAGGCGCGGTCGATTGAGCGACAGGGGGAGCACCACCACCACCACCTAAG
AAGCTGAAGTCGACATCAGAAGCAGGG