Description :
From Genome Similarity Track
Location :
Scaffold_61:87290- 89288
Transcript NameFunction/comments
g13905.t1XP_008907639.1 AGC protein kinase, variant 2 [Phytophthora parasitica INRA-310
g13906.t1RAW43718.1 hypothetical protein PC110_g142 [Phytophthora cactorum

Sequence
1998 bases(100 bases per row)
CTCCTGATTGGCATCGACCCTGGCATGAGAACCCTGTGCACTCCGGCGTGTGTCGGCCATCTTTCAACTCGCCGGCAGCGCAACCGACGCCGCAAGCGCA
ACAACAACGACAAGGACAAGCACAAGCGGCGGTGGAAGCGTAAGCGCAAGAATTGTCACGGCCAACGGATTGTGGAGATTAACACTAGAGAGTACTGCCA
TCTGGCCAAGTTGGACAAGCAACGCTTCTGGAGCCGCAATTTGAGAAAGCGTGAGACCAGGTATCCCACGAGCTGCTTGCAGCAATACCACCCTTCAAGA
CCGTCGACTACGATGTCTGCGTGGATCGCCTGCAGTGCTTTCTGCAGTCCTCGGGCTTCCTGCTATTGTTTCCGGCCCAACACTCGTTCCGCAAGTGGCG
ATTCCTAACGTACGGTATGAAGATGAAGGCTGGCCAAGCGTCTCGTACCGACTCGAAGCGTGCACGTTTGTGTTGCGTGTGGAGATTGGAGCTGCCACCG
GGGAAATCCGCACGGGCGTTCAGGAAGGCACTTGAGCGGCGAGCTACGGTCCTGCCCATGGATGAATTTCGAACGAGTAAGCTGTGCCCCTGCTGCCACG
AGCGCCTCCACCAAGCACGGCTGCTGACGAAGGTGAAGGACAACGACACCAAGTAGGACAGGTTCGTCTTGAAGGGGAACAGAAACGTTTGCGCTGTAAG
AACAGTCGTTGCAAGGCCCACTTCTGGAACCGGGACGTCAACGCCGCAAGAAAATACATGAGATTACCAAGCACCTGCTCGTTCTTGGGCACGGAGCGGA
GGGTTGCTTTCAGCAATGGCGGCAATAGACCTCTGCTGCTGGCTGCCAGTCGTGATTGCGACCATAGCCATAGAAAACCGGCAACATCTTGCGCATCGTG
TGCGACGTTTTGTGGTCTTTGAAATTGTACACGCGTTGCCACTTACCGTCGACGTTGGCGTAGCGGTGCGAGATCTCGCAAGCTTGCGCTGCTTTCGAAC
CAACAACACAGCCATCAAGTTAGTCCAACCGTGCAAAGCGTCCGCGCTCAAGCAAAGATGCCTACCATTGCACGCGGCGCATAAATCGTAATCGCTGCAG
ATAGCGCAGTTAAATCGTGGTCCGGTGAAGTCTGTTTCGCCACACGAATCGCAGATAAAGCCTAGATGACGACCGTCCATGATGTAGCGTAAGGTAGCAA
GCGGATCCTCGTGGCACTTGCGGAACGCACTGCGCACGCGGAATTTTGGAATGTCCAGCTTCTCGGCCAGGTTTTCAACCAGTTCTAGCGTAGGCGGCGC
CAAATCGGTAGGACTGAACAGTTGTCGTGCTTCTGCATAACGCTCGAGTAGCAGCTCGTACACGGGGCTCAGGGCACTCGCAGGTGGCACTCCGTGGAGA
CCTTGTGGTCTTACGCAGAATACCACAATATCCGCTTGCTGCAATCCAGCACTTTGAGCCGGCGCATGGTACGGGATCAATTCAGAGACAACAGTTGGGG
CAATTTCTTCTCGGAACATTTCCAGCTGTGCACAGCTCCAACCTGTATGACGAGCAACTGCCTCGTACAGCACACTGGGCGCGAGTCGTCCGCTTTCAGA
CTTGCCTCGGATTGTCGTGCCGTCGGGACACAATGTTTCAAAAACACGGAACTTGCCGATATAGTCTAGCTGGTTGGCAGGAGCTGGCTGGAGAAGCTTT
ACAAACACATAGCCTTCAGGGGTCGCCAATAAATCCTTCGCAGTCGCTTGGGCACCAGGCGGTAGATCAAGCGGGAGATCATTCGTCACAGAATTGTTTT
CAACGTATATCTGACAGAACGAATACGCGTCGATGTCAACTCCATCGCAGAGCAAGTGACCAAAAAGAGGTCGATCTTGCTGGGATTTGTCACAGGCGAG
CAGTTTGCGTGGCCGCAGTGCCTGACCTGACACCACTGGCTGGTTAAAGCACCACACTCGCGTCTTGGCCATCGCTCCTTCTTCACTGTAGTCCCCGA