Description :
From Genome Similarity Track
Location :
Scaffold_818:8729- 9734
Transcript NameFunction/comments
g8147.t1hypothetical protein

Sequence
1005 bases(100 bases per row)
ATGTTCATCATCTAGAGGCCGTAGAGCTGGCACTGTCGGCGAGAATGCGGCAACGTCACTGCGGAACGTCTTCAGTCCGTGTGTGAGCACAGTTGAAGTG
TGGTTACCTGCCCAACGGGAGATCATGTCTACCCATACATTGTCAGGACCAGGTACGTGGTCCACAATGTACCGGTAGTTCATGAGTTTTATGGCCCAAC
GTAGCAGCTTGCCCCGCACATGCTTCTTCACGCTTTCGTGGGACGCGAAGACATTAATTAAGTTGCGGTGGTCGCAGTACATTCGAAACGGCCGGGGTCG
AAAAAGTAGGTAGTCCAACTTATCGCATACGATGGCGATAGGGAACGCTACTTTCTCAATGACAGTCCAATTGAGTTGGCTGCCGGAGAACGTCCCACTA
ATACAGTGAAGGAGGCGATGTTGTTGCTCAGTGGCAGGCTTTTCCGGGTCAAAGTCAGCCACTTGGGTCACGATGAGGGCCCAGACCACGTCTGATGCAT
CCGTGAACAGACAGGTGGTGGCTTGGTCATCGGGGAAGTCGAGAGTAGCCGACGAGGCTAACGTCTCCTTGACTTGGTCGTATGCCTTTTGCTCGTCTCG
ATCAAGTTCGATATCGATCCCAGCCGCCGCTCGGCGTGTACGCTTGGTTTTGGCCAAGGCGTCATCCAGTTTATCTGCAAAGGAGCAACGACACGGGCAA
AATCGACGATAGTTTCACGCATCCAGTTGATGGCGCAGACGAATTGTTGTAGTTCGCCGGCTGTACGTGGATACGGCATCGATCCCAAAGTATTGATGCG
CTCTGGGTCATGTCGTACACCTCGATCGTCGATCACTCTACCACACCAGTTCAACTTGGGTCTGGTACAAGCTAGATTTCTTGGCGTTCAGGTTGAGTTC
AAAATGATTGAGTAGCGACAATAGGTCGGATAACTTGACTAGATATGTGTCAATGTCTTTGGCGTACAGGAGCAAATCGTCAATCCCGATCAGGAGGTAC
TCATA