Description :
From Genome Similarity Track
Location :
Scaffold_86:87285- 88853
Transcript NameFunction/comments
g7108.t1POM73604.1 GPI ethanolamine phosphate transferase [Phytophthora palmivora var. palmivora

Sequence
1568 bases(100 bases per row)
AACATCGCTCGCCTGTTGCTGCTGGGCGTGGCCTTCCACGCGCTGTGCATCCTCAGCATATTTGACATTCACTTCCAATCGCCCGTGGAGTCCTCGATCC
CCAGTAACGAGTACACGCTGACGCCTCCAGCCAAGCGGGTCATCATCTTCACGCTCGACGGTTGTCGCGTTGACAAACTCTTTAAAGCGGTCGCAGGGCA
CGCAGACCGCTACGATCTCAATGCGGAGAGCGCCTCGACGAGCACCAAGTTCGCTTCCAATAGGCGCACTCCGTACCTGGGCGACGTAATGCGCAATCGC
GGCAGTTGGGGCGTCTCTCACAACCACGCGCCGACTGAGAGTCGACCGTGCCACGTGGCGTTGACTGCTGGAATGTACGAGGACCCGCACGCAGTCACCA
AGAACTGGAAGCAGCATCCAGTGCCCTTTGACTCGGTCTTCAATCAGAGCAGTAGTGCCTTTATCTATGGCAATAAGGATGTCGCTCCCATGCTGGCTAG
ACACGCCCCGCAAGCGACGGAAGAGCACTACACGGCGAAAGAAGAGGTCGATATAATACGGGAAGACACGACGCTGCTGGATGTGTGGGCGTACGAAAAG
ATGAAGGATTTATTTGCACGCGGAGCGGAAGCGAAGGATCCAGATTTGTACAAGAAGCTGCACCAAGACAAGTTGGTGATTTATTGTCATTATCTGGGCA
CCGACTTGGCGGGACCCAAGTTTGGTGCTGATTCGAGAGAGTATTTGGAGAATATTGCGGTGGTGGATGAGTTGATTGAGAAGACGGAGAAGATGATCGA
TGCGTACTTTGGAAACGACAGACGAACGGCGTATGTGCTGAATTCAGACCATGGAATGGATCTCCGTGGTGATCACGGGGATAAGGATCCATCTAAAACG
CGGACGGCGATCATTGCGTGGGGGGCAGGTATCCACCGTCCTGTTGTGGTGAATAGGACAGGAGATGAGGGTTTTGATTTTGACGTGCCTACACAGTCTA
AAGCTGAGGTGCAGGTACGTCTGGAGTCCCAGGAGACTGAGGAGCAAGTTGCAGCACAAGAATGGAGAACGCTAATAAATTTCAAGCGCAAGGATGTGAT
GCAGATAGACGTTGCACCACTCATTAGTGCGCTAGCAGGGCTTCCATATCCTCGAAACTCGGTAGGTGTTCTACCGTTTACGTACTTGACTAAGAACAAG
TATCGTGTGAATGCCATGCGCGCCAATGCACAGCAGCTGTACCAGCATGCATTGCGCAAGGAAGAAGTGAAGCACGCTAACCGAGGGTTACTGTTCATTC
CCTACGCACCACTTCACAGCCGTGTGCCAGATCTGATGGCCCATATTGACGAAGCCCTCAACAGCATTCCAGCAAGTGACGGTGAAAGCCATGCAATTCA
CAACGAGGCACACCATGTCATCGAAAAGTTGATCCAGGAGATGATCGATATCTGCCGGAATGCGATCATATACTACCAGAGATATGACTGGTTGTTTTTG
CTAGGATCAGTCATTCTAAGCTACGTCGGCTGGGCTCTAACCATGACTGTTGCCTATTTACAGCCCCA