Description :
From Genome Similarity Track
Location :
Scaffold_159:8726- 10290
Sequence
1564 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCGGATCCGTAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTG
CTCCACCCCATCCCCACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTAC
ACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGCTGGATCCGGCAATCTCGCA
GATTTTGCTGATCCCGCTACACCACACCGACTTTAGGGCGTCAGTTGCGGTTTGCTCCAGCTGAAGGTGTGCTGCGCGCCCATACGTTCGGTGGCACCCG
AAAATCTTGTACTTCGTGATAAAGGCGGAAGGCCGTTTTCTCCAGGCTGCCCAACGCTGAGATTGAAGCCCTTCACCACAACGTCAAGATTCTCCGCGAG
TCGAACGCTAAGAACGACGCCATGCTCGCCACTGTTCAAGCCACTATGGAGCGACACGCAGAGGACTTAAATCGTCTGCACTGCGAGGTCCAAGCTCGGG
ACGTTTTCATCAGCACTTTGCAAAATAAGCTGGCTCGCGAACGCGAGGTGTACAAGTCTTCTATTGGAGCGAATACCGAGCAGACCCGGAAGCTCCACCT
CCTTCTGGTAAAGCTTGCCCAGGGCAAGTATGTTGATAACGACACGCTCAAGGTCCTTGAGAACCAGAAAGACCGTAACACTCGCCTCCTCCAAGCGAAT
CGCACCCTCCGTGCACACGTGAGCCTGGCCGGGATGGATCCCGAGGTACTTCGTCTGGCTGTTG