Description :
From Genome Similarity Track
Location :
Scaffold_14:87250- 89646
Transcript NameFunction/comments
Sapdi_VS20SDRG_05303hypothetical protein

Sequence
2396 bases(100 bases per row)
CCGGGCGACCGACCACGGCGCGCTTCAAACACCCAAGCGTCCGCTTCTCGCACGCTGTTTTGCTGTGCTCCAAAAAGAGGCCGAGCTGAGCTTGGCCCTG
ATGGTCCCGGCGTTCAAGGTCGAGCACGACCTAATCGTTGTGGCCGCCGGCGACGACGACAAGGTGGTCAAACGAAGCCATGACGTGATCACGTCACCAA
TGTCCTTTGGCGGCCTCGACCAAGGCGTGGGATCCGACTTGACACCGCTCTTGCCCCTGGGGCACGACTGCAACGACCTTAGTGTCACGTTCTGGATCTA
CGTCGACGGCGCCAAAGCGAGCGCGGTCGCCAAGCAGTTTGTGTTTGCGCGCACCAGCCGACGTGACGTCGCTCCGTACTGCGTGCTGTACGAAGCCAAC
GACGGCGACGACGACAGCAGCGAGTACGTTGTCGAGATCGGCGTCGTCGCCGGCGACGGCCACGACCGCCTCCAAGCCATCGAGACGGCGTCGTCTAAAA
CGCCGCTGCTGCCCAATCAGTGGTACCACGTCGGCATCGTGCTCGAAGGCCCCAAGCTCCGGCTTTTCATCAACGGTGCGCTTGAGATTCAAAGGGTGCT
CTCGGCATCGGTCTCGCTCGTCGGCGCTGGCAGCGTTTGCGTCGGCAAGGCGGCGTCGCCTGTCGCCGAGATGCTGAGCGTCCACACGGGGCTGCAAGGC
ATGTTGGCGCAGGTGCGCGTGCACAGCCGGGCGCTCTCGGGCATTCATCTGCACATATTATTTGACCAAGGCCCGCCACCGCTGTACACGGAGACGGACC
ACGGATGCTATCAGATCGGAGCGCTGCTTCAGCTCTTGGCGCAGAGCAGCGAAGGCGCCGTCGAGCTCCTATCGCCGCGTTGGCTGCGCGTCGTGCTTTG
GATGCTGCGCGGCGGGACCTACCGCGTCCAGCAGCAGGCGCTGCGCCTCTTTGCAAAGCTCCTTCCGCGCGTGCCGCCGGCGTCGGTGCCGTTAAGCCAG
TTCTTCGTTGCCGACGGCGGGTCGCTCGTCCAGTACTTTGTACGTCTCGTCGGGTTTGGCCTCTGGCGCTTTCACGCCGTGCCAGGTGCCGGCCCCAAAC
TCGGCGTTGACTTTCCGCTCAACCTCGCCGCGCATTCGCTGAGCTTCCTCGAGTACGCCGGTGACAACTGCTTGACGACCGAGACAGAGCGCAGCCTGCA
TCTGGCCATGGAAACGTGCCGCCTCCTCACGACGCTCGCCGCCGACGCAACGTGGGCGGAGGCCGTCGCGGAGCATCTCGCAACCTCTCTGGAGGTTATG
ATGCGTCGCTGCCGCGAGTCGGCGGCTGCCGACGTCACGGTTGTCGGGAAAGCGCGGCTTGCGGCGGACGCCCTGGACGTTGCCGCGGGTCTCGGCGCAC
TCGCCGTGCTCGGTGGCGCCATTGACACGGTGCGCATCGGAGCTGTCATGGAGCTCAGCCACGGGCGAGACCTCGGCACCGTCGTCGCGTTTGACCCGTC
GCAGACGTTCGCCCAGCTCGTACTGCAGAAGATCGCCACGACCACCGACCACGTGACGACGCATGCATCCTGGAGTGCCAGTGTCCACGCGACCCCCTTG
AATATGGACACATGGAAAGTTCTCCGCCTCAACGTCGACGAACTTGCCGTCTCGTCGTCCGACACGCAGCTGTCGACGCGGTTGCGTGCACTCCTGCTCC
ACGCGGCGTCATCCATATGCAACGACGGAGCGAGCACGCCGTTGGGGCGTCAGAGCCATGCGCGTGCGCTCAAAGCCTTGGCCGTGGCCGTGCGGTTCCA
AGAGACATCAGCGGAGCTGTTGCGGGCGCACCCGTCGCTCTTCCAAAGCCTCTTGAGCCTCGCCGTTCAAAGCGACGGGTCGTTGGAGTTCATCACCCTG
GCCGAGGCCGAGCTCAAAGCAGTGCTGTTGCGGCGACGGCAGTATGAGCTCTCGGCAGCAGCGGTCGAGTCCACGACCATAGCAACGACCCAACGAGCGG
ACACGTCCCGCGACCGGCCACCGACGGCGGTCGGAAAAGGGTCGGAAGACGACCTTGGCGACGACGAAGCGGACGACGAAGCGGACGACGAGGACGACGA
GCGCAATGGAGAGGACGACGAAGACGAGGACGAAGACGAGGACGAAGACGACGAGGACGATGCCGACGTCCGCGCCGAGCTCGTCGAAGAGCTCTCACTC
ATGGGGTTCCCGGAAGATTGGTGCGTCATGGCGCTCAAGCACACGAGCAACGACATTCTATCGGCATCCGCGTGGATCGTCGACAACCTCGACTACTTCA
ACTCGCTCCAGGCCGCCAAGGACAAGGAAGAGCGGGAAAAAGACGCGCGGCTGGACGTAAACGAAGAAGAGGACGATGCGCCCGACGCATTATCGT