Description :
From Genome Similarity Track
Location :
Scaffold_83:8724- 13057
Transcript NameFunction/comments
Phymu_g3772hypothetical protein PHYSODRAFT_515366

Sequence
4333 bases(100 bases per row)
TACGAATACGCCCGACTTCCACCTCCTGTGCCAGGCGGGCATTGGTAATCCTGCGGCAACATGTAATTCTGGAGCGCACTGAAGCAGTATTGTGCTTTAC
CAATATTCTTTCGTGCGTTTTCACGACGAACACCATACGTCCGAAGAAGGTTGGTGAAGGCCTCCATGTCATCAGCCAAAAGCCCATGCGAGCGCACAAG
CAGGTTCGCTTCTTCGAGAGTGATCGACATGGACGTACGGTCTTTGGCCGATTTGCACATCGTCACACGGCCGCCCCCAACGGATCGGGCGATGGAGGAC
GATAAACTGAGAATGGCCATGCGTTTGGATCGGCCGGAGAGCTGGATGCTGCCTTTGAGAGCCATCAGAGACGTCTGAATGCGATCAAGGTCCTCCGCAT
CATAAATTGGAGCCGACGCCTGATctctgcgctgcttcttggaAACCCATTCTGCGAATTTGTTAACGTACGCCTCCAACTCAACCACGTTCTCGGCATT
GATTTCCTTCTGTAGCAAAGCTTTGCCGACTGTGTTCGCAACCGTCTGCATTTCATTCATTCCTTGCGAGAAAACCACGGGTACTACTCGAATCAGCCTC
TGGAACAAGAACTTCGCACGCACCTTCTGCTCTGGCGTCGATAACGACAAATAAATGGCTCCTGAGACTGCGTCCTGCCCTGGAACTCGGTGCATACTAC
GATCGGGGAAATCGCTTGCACGGCGTGTAATTATTGGAAGCTCGATTATGATGCCCGAAGGCCCAGAAGTGATCGAGACAcggaaagcagcagcacgcgg
cGACTTCACAGGACGCAGCTTGATGTGGACTCGCCCGAGCTCCTTGACGGCCTCTACCGTGTCACCCAGCATTCCTAATTCGTTCCCGTAAGTTGATAGT
AAACTTTCCACCGAAAATAAGAAGCCAACCCGTGTAAGCATTTCGAGATAATCGATACCGCAAGCTTTCAGAGGGTGAGGGCCAAAATCACGGTGGTCGT
GCGTATGCACGTAAAGTGTTTGCTGGAAACACGTAACAAGTGCACTCATCGCCTGGCAAAAAGCCACTTCAAGCCGCCGCTCCACGTCCCATTTGAGCTC
GTTGTACTTGCGTTCTAGCGCGTTCATTGTAAGATCCGAGCCTGCTTGTGCTTCATTCAGTAAGCGCGCGTGAAGTTTTTCCAGTTCGTCGCGCTTCTGC
CGAACGCCCCCCGTCTTGAAACCATAAACGTGGGCGGCAAAAGCTCCGACCGTTGTAGTACCGTACATCCGATGCTTGTAAAAGGGAGGTCGGCCTTTTG
TATTTGTATCAATCCTCATCGATGCCTTCTTCATGTCCACCCCAGACTCCGATCCTTGCGACGACGATAGGCTTCCACTGTTCGGCTTCACTTCGTCACT
ATCTAACCCGCTTAAGATGACATCGGCAACAATGTCGATCGCATCGGAAGAATCAACGTTGTCATCCAGTCCGTAGATGCTTTGaaattcttcttcagtg
aTTCCCATTGCAACAATGGTTTCTGCCAGCTTTCGCTGCTCAGAAGGAACGGAAACACCctgaccagcagctccctTGTTGACAATCGTTTCTGCTGAAT
CAAATGAAATCACGCGCCGACGTAGCGCCTCAACAGGTTCCAGAGGCGATTCTTCGGACGGTGAAGGTAATTCTTCTTTCTCATACTTGATATCATCGTC
TAAAAACTGCACAAGATCAAGATCAGTCTGTTGTTCACGCACACTCGACTTTCTCGACAGATGCAGGGGTGACGCCATGACGCTCCCCACGAATGAGTTC
ACGAGACGGGCATAACGCACTGCACTGGTTTGGTCGCCAATTTGAACATCCTTTTCTGATGTAGGATATGCATTGCCCACCGTCatcagctgctggtgaa
gatTTAGCGCCAGGAAACGCAGATCGGCATCTGCTTTCATGGTGCTTGGTTTGAAAGTAAGTCCTGCGTGCTGGGTAGCTCCGTACCTCAAGATTGagtc
ctccacctccgagATATATtgctccatcgtcttgaCAAGCTCAAACCGCCACTTCCGCTTTTTCCGCTCAACAACATCATCCTGTATCTGAATGATCATC
TCAGAAAGCATCCCGATACTGGTTGCTGGTCTAGCTCGGTTCTCAAGTGTAAGCGAAGAACTCATGCCGGAAGCGGTCGATTTCAATGATTCCGAGTCAT
CAGACTGGAGTGGATGGGCTGTGTCATGTTCTCGCACTGTGCCAAGGGATCTCGGAGAAGCTGGGATGACCGAGGGGAAGGAATAGCCACCAACACTTGG
AGTTGACAGTTGGCTAGAAGGAGTCGATGAGGAACTCTCGTCGCCATCCTCGAGTGCAATTTCACGCTTTAGCGCATCCAATTTCACCAGTAAGTCGGAT
AATATCAACTGTAAAAGTTGATAAGGCACCTCCCACGTGTACACACTTTCGatcagctcttcttcgactaGCATTTTACCTTGCGTCCGTTGAGAGGTAG
ACGCGAGGTTAATTATCTGCTGGGCGATCTCGGAATATGCGGAATCATTGTGGACTACATCATCCTCCGCATCGGCACTTTTACACCCAATATACATGAA
CGATCGAGTGATGCGTTCAAGTCCATCAGTAGACATTCCGGTATGCAAGCCCTTTACCTCAGCTTCACATCGGATAACGATTTCACCTGACGATCGCGTC
CGAGACAAAGGGGAATATAGCGAAAAAATAGCTGCCCGTCCGACTGCGAGCGTTGACCCCACCATAAATGATGTTAGAGGAACAAAAGGGTCGCCAACGA
GCCACTGACTATCCAAGTTCTCCAGCGAGTTCAGGTTTCGAACCGAGTACACTGAAGCACGGAGCAGGTCCTGTTCGCGCATTTCAACGGCCAGCATCAT
GTGAAAGCATGGGTCTTCTGAGTAGGATATTTCAGTTCGGCCGATCTCCGCTAGCACCCCGCCTGTCTCGGCATTCATCAAatgcagcaccacgaacgaT
GATGACCTCACTGATGACATGGAGGGCAGCGTCAAATTGAAGCACTGAAATGATAGCCATGCACAAGGGGTCGGTGAAACAGACTGCGctggccacttca
actcgTTGTCCAATGATCCATCCATCCCGGCTACCTGCCTTTCCTGCATCTCGTAGTCAAACGAACCCAATGATGAACCAAGACTGCACGTGGGATCAAG
CGCAGAAGCCCTGTCCTGCGGTTGATGTTCTTTGTTGCCACCGCCCAAATGCTGCCGAACGACATGTTCCAGTCGACGTTTAGCCCGATCCAGCACGCTG
TTCCCGAGGCCTAACGACAGCGGACTCGGCCGACGACCGAGCGTTAAATATCCACCCTGTAAGCCCGGAGGTGAATTTGGTGCCGCCTCGGCGTGGTTCA
TTGCCGCTACCAGTAGCGGCCTAGTCCTcacttcctgctccagtaaCGGCGTGGTCTCCGATGTCACTCTTCCATTGTTATAACTGAGACTTCTTCTAGA
CGGGATCTCGAGCGTGGGCTCCACCTCCCACATAAGCACTAGGAACAGCACACAGGGAACAATCTCTGGAATGGCATAACCCACCACGACACACACGTCT
GGATTGTGTATATCTCCACAGCCTTGGTGCGAGAACGGTCTCTGAATGTAAATAATTGTCCTCAATAGAAACAACACGGAGCAGGCTCCCATCACCAAAA
TAGTGAACCTTAGAGCCCTggtcagcttcttctccactcTCTCGTCAAGTCTGCGCCGTAGTCCGTCCCCCGATGGCTTCAGAACTCTCTCCACTCGATG
GCGCATCTGCCACGTGGAGTACAAAAGCCCCAACGAGCTGACCAAACTCCCTGTAGCGACGAACAGCACCGGCAGCACGCCTGTCCACAACGTCGACCTG
TTGATCTTAGCTTGAGCATGCTTTGCCTCGGCCACTTTGGCCTCATGGAGTACTGACAGGCCTAAAACAGTGGCGTAAAAGACGCCGTTGGACACTATAA
AGGCCACCCAGAGTCTTCTGGAGCGTCGGGAGACCTTGGGGTTGGCGATATCCAGCCAGAacagcgtctggaacagcacgaggctgaagaagagacaCAA
AGAAGCTCTATTCAGCAGGTTGCGCGCCACATCTCGGCCCACGAACGAAGCGGCgcggaagaaggcgaacagAACCATAAGCTGCTGGAATGTGCTGCGC
TGCGACCGCTGCGACCGCGAAGACAGCGCGCGACAGGCCGCTACGAGCGCTAGCGTCAGGTACAGCGCCACACATAGAAGCTCCAGGGCGGGGGACGCCT
GCGGCAGGAACACGAGACCGTCGTCCGGCGCCg