Description :
From Genome Similarity Track
Location :
Scaffold_7:872005- 874866
Transcript NameFunction/comments
Hyaar_Emoy2801557AlNc14C7G927

Sequence
2861 bases(100 bases per row)
GCTGTCGTGTCTCGCATTTCTCCCGTTACTTTGCTCTTTCACGTGCACGGACTTTCATCTTTTCCGCACGTGGCTGTGTTCGTGGTTCTCTTCCCGCACC
ATACAGAACTTTTCAATTCGTCGTGCATGTTGAACACGAACGAATCACGTCGTCGGGCATCCCAGCCCCTCGTCACGCCACCCCCACGACTGAACTTGCA
AACCCTCCACCAGTCGTCGAGCTTTCTGCTTGCAAAGCTCAACGTCTTCCGACCTCGTGCGAAACGAACAGCAAATGACGCAGACAGTCAATGGGAAGCT
CAACGGGACAGCAACATGAACCCGATTCGGCGGGTTAGTGTAGTCTCCCGATCGTGTGACTCCAAAGATGCCGACAAAGACCCCAATGTGGCTAAGGTCT
CGGCGATTCCGACGATACGTCGAGAGCAAAGCGATAAGGTGCTTCGTTGGAGTGACATCAATACTGGAGATGAGACCGACGAGGCCGAAACGTCTTCAAG
TGAAAAGTCCTCCATGTGTCTCTGGAAACAACTTGCCCCGACCACGAAGAGCGAAGCCAACCAGGTCACCGTCATGTACTCCATCTCGTTTTACCCGTGG
AAGATGGAACCCCATTGTTATTATTCGCATCCAGAAGCTGCGGCAAATTGGGTCCCCGACACGGCCAGTACCCGCTGTCAAACCTGTCTCGCAGCGTTCA
CCCTAACACGTCGACGACACCACTGCAGGCTGTGCGGACACCTTGTGTGCGCCAACTGCTCGCATGATCGAACGTATCTGCCATTTACTGGCTCAGCTCC
AAGTCAGCACCGACTTATTAAAGATGGCGCACCTCAACGCACGTGCAGCTCTTGTGCCAGTACGCTACACAATATGGCTGCACAAGACGATTCGCGAGTC
AAGCGCTTCACCATTGCTGTCTCCTCAGCACGACAACGTACACCCGTTGCATCAGCTTTGTCGATCTCTTCAGCCCGGTCGGTGGTTGCGGTAGACGTCG
AGCGACCGTCCCCGTGGTTAAGACGCACTGGTCTGGCTTTCACTGACAGCGACGTCGAGGATGAAGATGTTTTCACCAAGTCCACGGCAGCGTTGCAACT
CGATCGAGGTTCTCACAGACCTTCGCACCACTGTCCAGTTCGTCTTTCAGCCATTCGGGCAGGAGAACTGGATGATATCCTGAGTGCGCAAATAGGTTCT
CACGCGCTCTCTGCAGCAGTAGATCGTCGTGGCAATTCAAGTGTCCGACAATTTGTCATCAGCTCGGCGTGGCTTCACCAGTGGTTGCGGTATGTCCGTG
TGAATCCCAATACTACTGAAGGGGAAGCAGCAAACTCATCGTCGACGCAACAAGTGTCATACGAGAACTATCGAAATAAGGCACAGCATCATAAGTCGAC
TGTCAAGTGCCGACTAGCAAGAGCTCCTCGACCGGGGCACGTGGCGAATTACATTCTCTTGGACTTTATGAACGGGGAGTTGGTGCCTAAGCCCAACCTG
CAACGAAGCAGAGGAAGTCATGTCGGAGGAGACTATCGAGTGGTTAGTCAGGAAGTTTGGACCGCCTTCTTGGGACTTTATGGTGGTGGACCGAGCATTC
AAGTATCTCTTAGCAATGCTGCTGCTGTTGGAACAATGGCACCTAAACTCGACCAACCTCGACCGTCAGCACGCCCCCCATGGACCATTTCTGAGCTAGA
CAACTCGTTTTCAGCTCTGGCTACGTCTTCACCCATTGACAACTGCTCGTCGACATTAAGAGAGAGCGCAACGCAAAGACGTGAAAAGGAAGTCATGCTT
CAAAGTATTCAAAACACTTCAACGAGATCGATGGCAAGACGCCACTCTGCTCATGGAAAGCACTTGGTCTCAGCCGCTTCGATCTCGACGCACGTGGTAC
GACAACGGGGTGGCACTCGAAATCTTCGGTCAAGCTTACCCTGTCAGGGACTTGCCAGACCAGGCGTAGGCGACAAGTGATCAATCGAGCATTGAACTGA
TCGAAGAGCGACTTCAATTACTTGGTTGTTCGAGTACTACATTATTGACGACGCTACATAGCTGCAGTGTCGACACTTGCCAATGCTGCCACGTTGGTAT
GTCAGCAGTCAGCAAAGTCCTCTCTTGCTACTCTCCTTGAAACAGACGACCATCTATGGTAGGAACGTAGTGCTAAGTTTCTGGCTCTAGTAAGAAGTCG
AAACAATTGTAAGCAGGTGATCGGATGGATCATCCCAACGTTTTACTGCAGCTATGAATATCTGCTTGTCCAACCTGTTTATCACGGTCGTAAGCTTCTG
TTTTGTTTGATTTAGGTCGTCGTGTTGGGCAGCCTATCCCTTAACTCGAAAAGACGCTCTGTACTGAGAGCACTTTCGACCAAGGGGCTCCTCCAGAGAA
GGAAACCTCAACAAATATTGGTTTTATAGGAGCAAAAGTCGACAGCACTTTCATGTTTGACGCAACAAGACGTTATGGATCAAACCTCTGAGGGTTTGGT
AAAAGGCAGTGCCGCCAAGAAAGTGTCTCAGACGTCAGATCTTGTGTCGATAAACGAGTCTCAGCTGCTCCCCCGACTCCACCCTCACGGACAAAGTGGA
TGGCGATGTCTCACGTCGAGCCTTTGGCACCATCGTTGAGTCCTCATGCATCGTTAGAAGCCACTGGGCTGAACCATTTGCCTGGATCACAATCGACAGC
TTGACGTCCAGCAGACACAACTTCGACAGGCAATGCATGGCTCTGTGTACTCGAATAAGTCCTGCTGTCGAAGAACGATTGAACGTACACGTATCGTGTA
ACCGCTCGCTAGAGTTCATCTGGACTGAGCATTGCCCCCTGATACCGATGCTCGCTCATTC