Description :
From Genome Similarity Track
Location :
Scaffold_196:872- 2803
Transcript NameFunction/comments
Physo_144533reverse transcriptase

Sequence
1931 bases(100 bases per row)
TCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGG
GAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAGACACTCG
CTCCAGTGTTGGAACGGGTGAGCGTAGCTCTTAAGCACGTCAACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGACCGTCTGCGGATGGTCCGCAGTCG
ACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAGAGATGCGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGTCATG
GTGTTTGAACACCATGTCAACGAACAGACGTGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCACAGCAAGATGTACCATCTTGCTGAAGCGGTCAACA
AAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATATACTGCCAACACTCCGACGGAGTCGGTAGTGACT
GCAAGGGAGCCTGCGCGAAAGGCGCAGGCGTCACACGTCGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGGCCCAGTAGAAG
TCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCATACATGATCCTGAGTCGCAGGTCGTGGTCAT
TGGGAACGACAACACGGTCCGCGTTGTCATCGACTGCACTGTAAAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGG
CAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCATAGGTCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGT
GACGACGTTGGGGTGCTCGATCGCACGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACAT
TGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCTGT
CCGCAGCGACGTGTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTG
TCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATC
CGATTGCGAAGTCGGATGCGTCGCACACTACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCACCTCAGTCAAGCCCCTCTTGACTGCATC
GAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGTGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCACGTAGTCTTTCACGTACTTG
CACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGA
CACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATGTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGC
AAGCAGCTTCCGGAGATGCACCTTGTGTATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAG
TCGCGCACCGAGCGCAACAAGTGCGTCACGC