Description :
From Genome Similarity Track
Location :
Scaffold_3040:872- 2260
Sequence
1388 bases(100 bases per row)
CGCGCGTAATAGTGACAAATTTGTCGATACTCATCTATATGCATGACGTATCGGGACGACGAGAGTCTCGCGCCCCTAGTGCGGTTCCTCGCCACTGGTA
AGGGTGTCAATGTCGAATGGCTGTCGCCTCGACTACGAGTGGATTGACGGCCTGCTTCACTACCGCGTGGAGATAGGTGATCCTCCTCGAGTAGTCGTTC
CGAACAACAAGGACAGAAGTATGATATACTTCTGGGAGCGCATGGCACCTCTTCTCGCGGCCCCGATGGCCGCGAGAAGGCCTTCCAGTCAGTCTCTCAG
ACATTTTGGTGGACCCACGTGTACAAATGGGTCGCCAAGTACGTGAAGACATGTGAAACATGTCAGTGTGGGAAGCCTGCGGGCCACGGTTCGGCTCCTT
TGCAGAGCCTGCCAGTCCTAGAGGACGGCTGGAGGTCAATGAGTCTTGAATTCGTCATCGGCCAGCAGGCCGATGACCAGGACAACACCGACATTTTGGT
GTTTGTGTgtcgcttgagcacgaaTGTACATCTCGCTCCCGTTCCTGACTCGGTAACCGGGGAACAAGCCGCACGGCAGTTCCCTGATAGCGTGTTTTGC
TTTCATGGTCTCTCAGAAACCATTGGCTCGGATCGAGACCCGCAGTTCACCGCTGCGTTCTGGAGAACGCTGTTCCGGTTGTTAGGAACAAGCTTGCTAT
TGACAACCGCGGACCACTCCCAGACGGATGACCAAACGGAGCGCGTTAATCGCACGCTCAAGGACACGTTGCGTTGTGTTTGTgcttcagcaccaagcaC
GTGGTCCGGGACGGTTGCACATGGTTCAGTTCGCGCTCAACAACGCGGTGCACTCGTCAACGGGGTTCACGCCGCTCTATCTAAACGGGTTACGTCACAT
CAGGGTGCCGCTGACTTTGTGTGGGAGCGCCGAGGCTTCGGTCGTAAGTGGGGGAGGCTGAAAAAGCGCTTTCCTTCCAGGTCTCGGAAGTGGTACCATC
CTCCTGTGGAAGCAGTTGTCAGGGTTTATTGACAACTGGCTGAATGCAATTAGCCGGGTTAGAGATGCAATGACATCAGCTCAAGCTAAACAAAGGAGTA
CTCAGACAAACATGGAAGAGGAAACTTAAACGTGTTTGATGTGTGTGAGTTAGTCCTACTAAATAGTAGTAACTTACCACTAAACACGGTTAGTTCCATA
GGGAGCAACAACCTGAAGCGCCGCTTCATTGGACCCTCGCGGTCCTGAGTAGGTACGACCTGTCTACACATCGCCTTGCCTAAGTCGATGACGACCCACC
CGACGTTATATGTGGGTCGGCTGAAGCCGTACCACGACCAACAGGGTCCGGCTGCCCCGCTGAGGTGAGTGCACCTCCTCAAAACGAG