Description :
From Genome Similarity Track
Location :
Scaffold_3063:872- 2177
Transcript NameFunction/comments
Phypl_g15591hypothetical protein PHYSODRAFT_342937

Sequence
1305 bases(100 bases per row)
GACGTGACCATGGAGTCCGTCAGTTCCCACTCCGCCTCCAGGCACAAGCGCGACCATGGTGAGGACCCGGACGATCTGTTGATCTGGACAATGGTACGcc
gggagctgcagccgcgatTTCATCCACGACAGCCGGCGCGGGTATCTCTCGCGTATGTCTCTCGGCCTTCTCTGAGTTGAAGGAGTTCCACGGACGAGAC
GCCAGCGAGGAGAAATCCAGAGCGTGGCTAAATCGAGTGAAGTCAGCGTCGCGCCGTGACGGTATGACTGGGAGCAAAGTCTGTGCCTCGTTTGGAGACC
TGATGGCAGGACCCGCCCGCCAATGGTATCTGcagctgaccaagaagatcCGAAAATCATGGCCGGACTTGATGGATCAATTCCGCGTTCAGTACTGCGG
CAAAGGCGTGTCTATGGCGAGCCGCTACTATCACGCGGCCAAGCACCCTGACGAAACACCCCTGGATTATCTGTATCGACTGAACGTCGCCGGCATGCGG
GCGAAGATCCACTACTTGGACGGCACGACTGAAGAGAAGAGGGAACACGTGGAGTTATTCATCAACACCCTGGGTccccaagagcaagagctggCATCGC
GACTCACCTTGATGGAAGTGCCTGACACCCccacgctggagaagaagctgcacgccaGACAACGTGGACTGTCGCATCAGAAGAAGACTTTGTTCGGGTC
GAATAAGTTCAGGCAGAAGgtaccagctccaccgcAGCCGGCCCGCGCAGTGCAAGCGATCCAAGCCACGCCAGACAGGTATGACTCGGGACGCGAGAGC
CGATCTAGTGACGATCCGATCTGTGACCAAGATCGGGATGACGAGGAACGGGCGCGATTGTTCGTAGCAGGTCAGACGCCGCCGGGGGAAATCGTCCGAC
GCGATCTGGGTCAGGAAAATCCGGGACGGGATCGCCCCCGATGCCGCCACTGCGGCTCGCGACGTCACTCCGACGACGATTGCTGGAGTCTCCTGACATG
CCAGAAGTGTAGTGGTCACCACCCCACCGACCGATGCCTGCGAACTTGTAAAGCTTGCGGAGGCGTTCATGAAGCGGGAGAGTGTCCTTTGGAAGAGTTC
TTCAACCAGCTACGCCAGTGGTATAACCCGCAGAAACATGCGGgggtgctgccgccgtcggccGAAAAGATGTTAAACTAGATCGCTCGCTGGGTTGGAA
TCCAGTACGAGACGAGCGATCTGTTTCCGTCTATGCATatgtggccaagaagccgacAGAGGTGGTTAGTGAgagatcgacgacttcgaACGGTAATACA
TGTGA