Description :
From Genome Similarity Track
Location :
Scaffold_1162:872- 1875
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_18383pectin lyase, putative
Sappa_CBS223.65SPRG_18384pectate lyase/amb allergen
Sappa_CBS223.65SPRG_18385Hypothetical protein

Sequence
1003 bases(100 bases per row)
GGCAAAGGCCTCTGACTCCGCGGCGAAAACATCATTCTCCAGAATGATGTCCACGTGACGAACCTCAACCCGCAGTACGTCTGGGGCGGCGACGCCATCT
ACCTCAACGGCAAGCCCGATGGCTCAGCTAAAGATTTGGATCGACCACGTTAAAATCTCCAACGTCGGTCGGCAGATGCTCACGACGGACGGCGCCAACA
GTATCACCGTAAGCAACTGCGACTTTGACGGCGAGACCGAGTGGTCGGCCACGTGCGACGGCCGCCACTACTGAACCAACATCTCTACCAGCAACCTCAA
GGTGAGCTACCTCAACAACGTCATTCGGAAAACCTCCGGCCGCGCGCCCAAAATCAACTCGGCAAGTACTCGGTGCAAGTCCACACTGCCAACAACTACT
GGCACGACAACTCGGGCCACTCGTTCGAGGTCGACGAAGCGTACGTGCTCTCAGTAGGCAACTTTTTCGCTGCGACCGCGTCGCCCAACCTCGCCGAGCC
CAACGGCTAGATCATGTCGACGACGAACGCCAACAAGGGCAGCTGCAAGGCGGCGCTCGGTCGCGACTGCGTCCCGGACGCACTTGTCAACTGCGGCGAT
TTCGTCGACCACAGTTCGAGCCGGCCAAGATGAAGGGCCTCGCCACAACGTTCGCGGCCAAGCCTGCTGCGCGTCTCGCCTTGTCGAGCGCCAACTTTGG
TGTCGGCAACCTCTAACCTAGACCTATGGTTTAACACGATCCTGGAAGCAATTAACGCTGATTGACGCACATGCTTGTGTTTAGCACATGGGTTCAAGTC
GTTCAACGCGCGTCTCGTGCTGAACATAGAGGGTAAAGTCGTTGAACGTACTTGACAAGTGCGTTAAAGACGTTGCACGCGATCGCAGTGCGAGATGACC
TTTCGGGTAGGATCGGGCAGCATGGACGACCGTCGCGCGTGGCAGCTCGTGCGATGGCTGCTGCTGCTAGCGCTGAGCGCACTCGTGAGTAGCAACGAGC
TCG