Description :
From Genome Similarity Track
Location :
Scaffold_68:8718- 31641
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_68-snap-gene-0.22Protein IWS1 homolog
Pytir_DAOMBR486maker-pir_contig_68-fgenesh-gene-0.10Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_68-snap-gene-0.30Conserved gene of unknown function
Pytir_DAOMBR486snap_masked-pir_contig_68-abinit-gene-0.55C2 domain containing protein
Pytir_DAOMBR486maker-pir_contig_68-snap-gene-0.32Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_68-fgenesh-gene-0.4Cytosol aminopeptidase

Sequence
22923 bases(100 bases per row)
GAGCCCGAAGCGATCGAGTAGGTTGTCGTCATGCTGCCGGCGCTGTCGACCAAGCCCAAGCAGGCGGTACGGCAGGTCAAGGGGCTCACGAATGACTCGA
TCGACGCGTACTCGAACACACCTATGGGCGGTGGCGGCAACGCTATGGTGTCTTATGCAGACAACACCACTGACGGCAACAGTGGGAGTATGACTGCGCG
CGCCTCGCCTCCGTCGACGAGCAAGCCGTCGGGCGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGTCGCGGAAGTGACGAGGGGTCTGG
TAATGGAGGTAGTGGCGGGACTAGCGGAGGTTTGCTCGCTCGCGTGGTGCGTGACCGCAAGGCCTCGGGCGACGAAGAGCTCAGCTTAAAAGCCAGTGAC
GTCGTGCGCGTACTCTCGACCAAGCGCACAGGGTACCTCAAGTGCGAGTTTGCGGATGAAGTAGGTTACGTGCCATCGTCATACCTCGAGTTCTTCGACG
AGAGCAATGGCGGTGGCGGTGGCGGTGGCGGTGGCGCAGCGACCGAGGACGCTGACACTGGCGAGGAGAACCAGCGCGCCGAGAAGCGCAAGAAAAAGAA
GGAAAAGCGCCACCACAAGGACAAGAAGCTTGTGGACGCCAGTAGCGACCCCGAGGACTCGAGCGCGCTTGTGGCTGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATAATCATGACGCTGGAGGTGCTGCTGCGACGGGTGACGAAGGTGAGCCCTCGCCGCGCAAGAGCAAG
AAGAAGAACCACAAAGAGAACAGTAAGTCCAGCAAGCGCCACCACCACCGCCACGACGGTGAGGGCGAAGATGCAGTGTTAGACACCACACTGAAGAAGA
CGAAGCAAGGAGCAGGCGACGGCACGGAGCGCAGGAAAGCCAAGAGGCAATACAAGAAGAAGCGCCACCACCACGACAGCAGCGACGCTTCGAGTGAGAG
CGACGATGAAGGATCGCGTCACAGGAAAGGGAGCCGACGTCATCGCAGCCGTCGTCGTGGACGCGGTCGTGGCAGCGCAGACAGCGACAGCGAGTCGTCA
TCGAGCTACTATAGCAGCTCGGACTCTGGGTACCACTCGCGTCGCCACCGACGCCATCGCCACCACAAGGCGAGCTCGAGCGACGAAGACGGCTACAACA
CGGGCGACAAGCGCAAGGCGCGTCACCGAAGCCGCCACCGAGGGGATCGTGGCAGCGGCGGCTCGGACGCAGAGGACATCGACTCGATGCCGCGGCCATC
CCGACGCAGTGACAAGAAGCATCTGGATGCTGAGAGCGCGCCCCGCGGCGGCGGCGGCAGTAGTGGTAAATCTGGTAAGGGCAGAGAAAAAGAGTCCTAC
ACCGCTGGAATAGCAGTCACTAATAGCAGCAGGGTCGAGAAGGGAGTGGCGAAACTCGACGTCCAGAGCAATGGCAATGACAACAAGGCATCGTCTCAAA
GCTCGGAGGTGATCTCGGACCACACGCCCGAGCAGGAAAGCAAGAAAATAGCAGCAAGTGATACAGCGAACGGCGCGTCGGCTTCTTCAAAGAACGACGA
CAGCAAGACGAAGAGCTCTCGATCGAAGAAAGACGACGAGAGCCGCGTCGAGTCGACCGTTGCGGCGCAGAAGGCCAAGACGAACCTGGGCAAGCAGATC
GGCGAGAAAATGCGCTCGCTACTCGGCGGCGGCAAGAAGACCGAGAGGTCGCACAAGAGCTCGAGCGGGATCCTGAACGCGTGTCCCGGCACGACCCAGG
GTGAGGAAGGTTGGTACGAGCACGGCGAGAACGAGCGCTATTACTTTGTATTGCTCGACGGGAAATGGAGCCTGCTCTACGGCCCCATGACCGAGGAAGA
CTTTGAGTTGTACTCGAACAAGGTACGTTTTGCATCTATCTCTTCTTATAACCACCACTTCATATCTGGTACCTAGCTTGAATGATGAACGAACTCTGTG
ATTGCACAATGTTCAGGTGCTGAATCAGAACCGCATGATCGAGCTGCCGCCGACGTACCTGCACAAAGCGGGCTACTTCCTCAACCAGGAACTACGAGTC
CAGAAAGTATAATCGTAGAGCTCACTGATGACTCTGGTCAACAGCAACGTCATCATCGCCATAGAGCTAGGATCTCCTCACCCCCCCCCCATGAACTATA
ATATACAGACACACACTATTCAGCATTGTTGGTTGAACTGCGAACCAGTTTTCTACTGTGTACGAAGGTGTGGAAGGACTTGGGTATACCAAGGCAGAAT
GCAAACTATGCATTATGTATGTATGCGTGTGCAACTATATACTACAGAGCTCAAAGTCACTCTTTTGACGACGATGACGACGACGACGGGGGTGGAATGA
AACTCGGGTCGTGGCTCACGAGCTGGGGGAAGAAGACCTCGGGGCGGATGCGTTCTGCTGGTTCAGCCGACGCCAGCAGCCATTTGGACGGGGACCGGAG
CATCTCCTTAAGCTCTTCGCCCAGTGACGACTTGCGTCGGGGACTGCTCGGACCGCCTGCAGACGTCACTTTCGTATCTTGCATGACGCTGGCGGTCTTC
GAGCTCCCAGGCTCGTTGGTTACTTTCCAGCTCGTGTGCTTTTCACGAGGTGAAAGCGCGTGCACCAATCTCTTCGACGGCGACAGCGACTTCCAGTCTT
CACTCCCAGCGTCTGCTTCAGCTTCAGCTGCTGACACGCAAGCTGAATCGGGATCTTCAAGGTCCAGGTGCAGCGACGACGGCACCTTTCGCTGCCCTCG
TCGGATCTCATCAATCTTCTTTTCCAGCATTTCCTGCTGGTTGCCCATTGTGTCACCGCCCTCAGTCACCATCGCGTAGATGCTTTCTTCATCGAGCTCG
CTCGAGCCAGCGATACCTTCCGTGTGGAACTCCATCGCGCTCAGCAACTCGGGCGTGCGGTGGATACTGAACGTGCCTTCCTTGTGCATCTTGACGAGCT
CGTCGAGGCGCGCACGATGCGGGATCCAGTGCGATGTCACCACGTGGTACGCCTCCATGTGCCTTGCGTTCAGTCCATTCGGCACGACGCACACTTGCTC
AATCGCATGCAACAGTGCTGGTGTCTCTTCGCTATGCAGTTTGCGGTTGTTGATGCATTTCTCCGCGTGGCCCACGAGCTTTTCGAGCATCTCGACATTG
CGCATGTAGCGCTGCTCGAGGATCTCCTTTGCGGCTTTCTCTCTCGCGCGCAAGTTGATGCACTTGTCATTTACTTCGCGTAGCAAAGCCTCGGTCTTCA
CCATGTGCATCTTGTTCGCAGCTTCAAGGATCAACAGCTTGTTCAGCAGTACTTTGACGCCGACACCCTTACTCGCGTCGTCGCACCAGCCGTAGCCGCG
CTGGAACCAGCGGTTGCAAAGCGTGAACGCTGCAGACGCCCATACGAGTCGTTGCTGGTGGTACGCGCCGAGCTGGCGCTGGATACGCATCGCTGTCTCT
TCAGATCCAAGAAGCCAATCGACGATGGACGCCTTGAACCCCAGTCGACTTCGATCTCTCGGGATCACCTGTCCATCGATGCTGCTCTTCTCGTCAAATG
GCAGCGAGTCCTGGAAACGATTCGTGGTCGGATCGAAACGGGAGCTGAAACTTGTGATCTCCTGGTACACCATCGCCGCGTAGCTCATCGCCGCGTAATA
CGCCATGGCACTCGCGTTCTTGCCGTTCGGACACTGGCTCAGCATTTGCTCTGTCGGTGTTCGGATTTTGCCGCAATTCGCAGCTTCAACCAGCTCTTCG
CGCGTGAACGCTTCGAGAGGCAAGCGGTACAGGTTGTTGCCCAGCGCATGGAGAGCGATCGCGATGTCTTCTTTCGTCACGATCTGATCCCGTGAGACGC
GCAACAGTGCACGCATACATCGATCAAGCGCAGCGTACGACGCGAGGCGCTTCGTGTACGACTCGTGGATCAAAAGCTGCTGGAATCGCTCGATGAGCGT
CATGTAGTCCCCGCTCATGTCGACCTCGGCGTACTCCGTCAAGTCCTCTTCGCTGAGCACCTTGGTCTCGCCGGGAAACGTCTTGATGAGCGAGTTGCGC
TTGCGCAGCGCTTCAAAGAGCAGCGACTTTCTCAGTAGTTCGATGTGCGTATCGATCAGTCCCAACCCAGTATTGAGTAGTCCGGGAGTAGCACTGGTCG
GTATCGCGTTGTCTTTCAACGCAGTGTTCACCGTAGTGTCGTCGGAGATGACAGATTGCGTGCCGATGCGCATTCCTCGCAGGAAGATTACCTCTCCCTT
TCGGTCCATCCCGCGTTCCTGCAACAGCGTTTGGATCGCAGCAGTTTGCAGTGGGAGCGACACATCTTTCACCTGATGGCGGTGCATCAGCGACAACACG
GTTGTGAAATTCGCTGTCGACGGAACGTCGATGCCAAACTTGAGCAGCTCTTCTTTCTGGAGCACGACCGTGAGCGTGCGCACGAGGTTCTCAATTTCGC
TCGTCGGGATCTGTCGTATCTTCATCTCGTCCAGCAGTTTGGTGAAACTCGTTGGAACTTCCAGCTCCTTGTTCGTGTTGACGACGTGGCTGATCTTCCA
GAGCAGGTCAGTCTTGCCCAAGCTCTCGATCACGGTGTACAGCTCTGCGAAGCGCTCCGGATTGCTGAGCACTTGGTGTCGCACGTCGTCCAGATGTCTG
TTCTCCACCGCATGCTCCAGTTGGTCGATCTCCTCCAGCAAGTCTTTCGGCAGACTGCTCGACGATGTGCTAGGTCCACTCCCACCACTCAATGGCTTAT
TGTTTCCCACGATGAAGCAGGAAAACTTTGGAATCACGCCGCGATCTTCTAGAGCAGCGCGCACATTCGCCGCAGTGAACGCCATCTCTTCCTGCGTGAT
CAGCAGCCGAGTGTCCTTCCCGTCTCGCGAGTACGGGAGCCAGTTGTTGCGCTCATGATCCGTGGTGATTCGATGACGGGGGATGCGCTGGAGTTCGTAT
TTCGCTTCTTCGATCGCATACCACTCGATGAGACCCTCGAGGCGGCCAGCGTCTACCTCACTAGTGTCCACACCAACTGTGAACGATTGAGCTGCACCGC
TGGTCGGGGGCAACGGCGGCGAGCTACCTAGATGCTTTTTATCCTCTGCGCCTTTCCCAGCCAGTCGGATCGACGTTGAAGACATGCCAGCAGTGAGATT
CCGCTTGCTTGGTGACGAACCGCTTTGTTGCAAGAACGCACTGTCAGGCTTGACGGCCTCGTTCATAGTGTTCACTTTGCGCTCTAGCAAATGCATCTTC
TTGAGGATGAACGGCGTGGCCTCGCAGTCAATCTTGTGGTCGTGATGCATCTCCAGCGCGTCGTCGAGCCACTCTTGGACCTGTTTCCAGCGGCTCTCGA
CAATGCCCAGTGCCTTGGCGTCCACGTCCGCGAATCCCTCGCACTGTTCGTTGAGCAGCAAAACCAGCTCATGCGTTCGTCGCCAGTGGAGCCCTTTCTT
CTCCATCAGGCGAAGCTCGCAAAGTGGACCATCGCGTTGCGTGATCGCCATCCATCGGAACTGAACATTGGCGACAGCGTCTGCGTGGCGGTCGTTCAGC
CCCTTACTGCACTTTTGCGACACCAGGTTGAGCAACTGAGGCGCTTCCCCCAAGTGGATCTTGTTGTTCTCCTTCATCTTCACTAGCTTCTCCAAGGCAG
TATATAGCACCATCCACTTCTGGTACACCTGCTGCCACGCAGTGCTGAGTACCACGTCGAGTCCCTCAACCGTGCTTTCAATTTTCTCTAAAAGCTCTGG
CGTGCGCTGAGCGTGGATTTGCGGTGCAGCTTGGATAACCAGAAGCTCGTCCAGCATTGGCTGCACGTTCGCCCAACGGTTGTGTACGAGGACCACTGCC
GAGCGGTACTCGTCCACTTTCTCCGCAAGCCCCTGAAGTTGGTCGCTCTCGTCGGCGTCGCTCCCAGACTTTCCAATCGCTTTCTTGTGCGAGGCAAAGA
TATCCCAGACCAAGCTCAGCAGGATCGGTGTGCGCTCCCAGTGTAGCTTCTTTGTGGATTGCACCTTCAATTCGTCAAGGTAGCCCTTCACCGTCATCCA
GCGCCGGCGCTGAGCAGGTACCACAGCCGCATTGATGCGACGACGCGCGTTTTCGTGCTGCATGATGTACTTCGCCTTGAGGAACTTGTACACGTGGATC
GCCTGCTCAAGCAGCGCGCTCTCTGAGTACGTCAAGCGAATGCGAAGATGCACTTTGCCCTGCTTCCTCGAGTCATGCTTTATATCAGCTAGTCCCAGCT
CCGCCCTTGTCTCCATCTGCAAAGCATTCGCGTACGGCCCTCGATTCGGCTTTGTCAATTTGTACGAGTTGAAATGCTCTTCTTGGTCAATCAGGTCCAG
CAACGGGATCTGCGCCATGCCAATGGTATCGTGGTCATGTGGATTCTGGTCCATGATTTTCACACGCAGTGTTGTGCCCATGATATCGTGCAGCACTTGA
CAGATCTTTCGCAGCCGCAAGCGCTGGTACACTCGCCGGTACACGACCTGGTCTTCTTCGTCCAGGTCTTCGACTTCTTCTTCAAAGATCTTCAGCATCC
GTTCGCCCGCCGCGCCATCAATGTCGTCGCCTTTTGCATCGTGTGCGTAGAGCTCTTGCAAAGTCGGGATCAGGCGGTATCTGTACATGTCAAAAAGCTT
CAGAATTGTTCGTCGCAGGCGGATTGTCGATGTTGCCACATTCGCATGCACGACCACCAAGTCGTTCCCTTTCGCGTGCCTGTCCTCCTGCACGCGATCA
GCAGACCACGGAACTCTTTCTGAAACGCTCACGATGCCAAGTTCAACGGCGGTGCCTTCAACAATGCTCTTTGTCTGCTTGAGAGCGTGCTTCAGCTGAT
CCATTTTGCGTGGCGATTGCAGCTTGTGCTGGTGCTTGATCTCAAGATCTCCTGCATGCGAGTCGGAGGCTTTCGATGACGCTGCCACAGCGCTACCGTC
GGTACTCAACACAGGTTTTCCCCTCGCGTTGATCTTCTTCATAGCCCGGGAGATTATCACCACATTCAGGATCTTTTGCAGCTGAACCTCTTGCTCATTC
GGATCTGTGAGCTTCACTCGTCCTCCGCTAGGCACAGGCGGACCTGCAGCTAGCAGTCCGCGCGTCAGCTTATCCTCGTGATGTTTCAGCGTCATCACCA
GCAGCTCGTACGGATCAATCATCCATAAATCCTCTTCTGTGGCAAAACTTCTCGCTTGCACTTGATCGTCCTTGAAAATGCGGTGTGTGCGCTCGATACT
GAGCGTGATCTTCCCGACAACAACCATGCGACCGTTCTCTTCGCGCCCCACACTGAAAATCTGAGTGTTTGGGTCACCATCTTCTGCTGTTTGCTTTGAT
TGGGTCCTCTCTTCAGTGTGGTGTGTGAATTCATCTTGGGTCCAAGCTTCGCTGCGAACAATGTCGTCCATAGAGATCAACGTGGTGCCGATCACAGCCT
CGGATCCTTTCTTCGACTTGTCCACCACCTTGATCTTGACCGCAACCACTCGTTCGAGATCGAATCCTGGGTATCCAAATACCACTTTCTTCATCGAATC
CTTCGCTTGGGTCCACCCTCCCGACTTTTTATCTCGAGCCAGATCCATCGAAGAGTTCTCGGGGTACTTGGTACGAGCCATATCGATGCAGATCTCTCCG
GTCGTTGTCAACACCACGCCATGCGGAGGCCTCAACAAAGCCTCGTCATTTGTGATCTGGGACTCAAAGTCGCGAGACACAAGCATAACCTCAGCTCTGA
TGCCGCTGCTGCCGTCCGCCTTGTCCTTGACAAACATTTGACTCACTTGCACGACCTGCACAACCATTCGGTCGAACTTGATGTCATCCTGAGAGATTGA
TACGACCTCGCTGCTCTTCTTTGATTCCGTATACTTGATCTGGTAGAAAGGGGGCACAAGTGCAACCTGCTTCGACCCTTCCAGCATCAGCTTGCGAATC
TGCTGCTGCTTTGGATGGTCCTTGTCATGGAATAGAGGTCCACTAATCACCTTCGCTCCCTGATAAGGAGCGAGAGCTCGTCGCAGCTTGGCTGCCAGCA
CAACCTTCTCAGCTGGCAAACAAATCTCGTAGGTTGTACTGTACACATCCTTGACCCTGAGTCGAGCATCGTCCAATGGGACAAGTTCCAAAGAAATCGA
CGGCTGCGATCCTTTCTCGGCTTTTCGATTCATGACCTCGACGACCAGTTTGCGTCCCTGATCGACCACGACGCCTGGATTTGCATTTGCACTTTCAAGG
ATCCAGATTCCTTGCCCCGCACCGACTGCATCTGTAACCGAGTCATGCGAACCCAGGTCTGCTAGGTAGAGCGAGCTGCAGCTTCCCAGGTTTTTAAGAA
TTTTCTCTGCATCTTGGTATGCCACAGTCACAGCAGCGGCGAGGCTACTCCTGTTGTTATGTGGGACAGCGAGGTGGAAATGTACCTGGATGCCTACATG
CTTCACCGAAGTTCGCACGCGCTTGAAAGTGAACTTGCTTTCGCCATCGACGACTTCGCCATCGCACGTCGACATGAGTGCGTTTAGCTTCACATTCCGT
GCAGGCTTCTTGTCAAAGCAGATCTCGACCTTATCGATCACCAGCACGCGTTCTTTTCGATTCAAAGGCATCTCCAGACTCGCCGTCGAGCGCACAACTT
TCTGCAGCAAATTACTGAAACTGGCAGGTTGCATCAGCGCGAGACTGAGAAGAGCCTTGAACAAGCCAACTGACTCGGTTGACGAGCTCAATAAGATCGT
TCCGTGGATCTCGACTCGCGGTTGTGGCGCGAGCAGCAGGCACACGCAGTTCTCGACATCAAATGACTCCTCTTCTGGGTTATTTCCAGAGCTGCGGCTG
TTGTGATGGCGCTGAGTGACTGACGCAGCGTACAGCTGGGCAAGCTTGGCCACCTCAACCTTGCTAAGATCGGACCCTTTGACGTATCCGTGGCACTGGT
CGACGAACCGCGGCTTGCTCTCGCTCCGTTCCCAGAGTTTTGCTTGCATCAGTTTGTTTGTGATGCCATCCCGCAACTGGATACTGGACACAGGGCTTGA
GAGGATCATGTACACCTTGACCACCTGGTTGTTTCCCCACAAAGCGTTTAGCTTCTTCGCCATATCACAAACAGGTTGTTTCTTTTCTCCATCATCATGA
ACTGTCAGCTGCGGCGTAAACACCGACCCGAGAAAGTATTGATCGGTCGCAAACGTTTCCTCTTTCGAGCGAAGCTGCTCGCGACAGATCCCTTCCACGA
GTGAACCATTGCTCAGCAACACGTCGTAGTTGACAACCAGAGACGGCGCTGCAGTAGTAGTAGCAGTACCAGTACCAGTCGTACATGGTACAAGATACAT
CGCAGCGACCTCGCCTTCGCATGTTGTACGCTCCATCAGCGGTTGAATGCGATCCCTACTGACATGGGAGTCCGTCGATGGGAGCTGCCCATCCAAGTAC
CCTACACGGTACCGAGCGTTGCCATAGTTCTTCATGATTTTTGCTGGTCGTGAAGCTCCTCGGGTGACACTCGACGCTGCTTTATCTGATGCTGTTGAGC
TCCCTGGAAGCGTTGCGGCACTTCCGTCCGAGTTCTCGAGGACTCGGACAAAATCTTCTTTCACCAATTGGGCGTGGGTGTCGCTTCCAAGAGTCCTCGA
GAAGATGGAATCGAGGCACACCCTCGAGATCCACTCCTCCTTTGGCTCTTTGCCGTCTTCATACACAATGCGGTACGGGTTCTGGGCATGATTCGTTTCA
TCTTGTTCGACGAACTTGCCGACGCGACCAGGCACCAACGAGTGGCTGTGGCTGCACTCTCCACTCCCGGTGCTTCCTGCCTGGGCAAGCGGACACACAA
ACACATTTTGCTCTAGAATCAATGGTGGGAGCTCATCGTCGTCTGAGAAATACTCGTCGCTCTCTTCACGAACTTTCGCGGCTGTGCAGAAAGCGACGTC
GTACGAATCGTCACCGTACTCGCGGATGATCGTCCCTGCCACGAACTGACCCGACCTCAAGCGAACGTCGACTGCGACACCGGCATGCTTGCACAACGGG
ATACTGGCGTGAACGCGATCCCCAAGCCGGAACAGTATCTCCCCTTCTTTGTCGTGGTCACCTTGAACAGCTTTCTCTTTTGAGAGGCTTCTCGAACTCT
CACTGGAAGCATGATGCGATAGCGCAAACTCAAAGCCCGTCCAGTCACAATTTGTGAACAGCGCCTGCACGAGCTGAGGCGTCTCTTGTCCGTGCAGGTG
GCCGGTCAATTGGTTCTTCGCTTCACTAACGTGCGAAAGGATCTGCGACCACCGATTCAGCACAATGTCCAACGCAGCGGCGTCTCTGTAAGACAGCACA
TCCTTTTCACCGCCGCAAAACACGTGCTCGAAGACGTAGCAAAGCAACTGCGGGGTGAACCTCCAGTGCAACTTTGTCGAGCGGCTCATGCGATGCACTT
GCGCCAACAGTTCCTGCGAGACATTTCGGCCAGGGAAGGTGTTCACTTTGAACACCTCCCAGAGAAACACCTGCGCGCTATTCGATAGGTGAAGCTGGCT
GCTGGTGGTACTGCCGACATGAAGGTTCATCGTCTTGGAATCAAACGGCATGCCCACGAGGCGAAAGGTCTCAGCGAGCACGCGCTTCACGCGCTCTGTT
CGATGGATACCGATCAAATTGATGTCGACCGTCATCCGCAGTTCGAGATCCTTGTTGTCTTTGTCCTTCAGAACGATCACCTCAGCTTGGTAGTAAGTAC
AGATGTCTGGGGTTTTCAGCAGACCGTTCTGACCGAATTTGCCCTGGAACGTTTTTCCCAACGCGTCAGAGGTGACTTGAACGTCAAAGTACGCGACTTT
CGACACATCGTAAGTTCGTCCCAAGAGCTTGCCCAAAGTTGTAGATCCCAGGGAAGACAACTCGCCATCAGCAGTTGCAGTCGAAGTCATTCTGCTTTGC
TGCAGTAAATCACTGAGCTTGTTTCTGGTGCCCACAGTGAGATCTTCCGAGTGCGGGTCATACTGAATACGCTGCCCACCGTCTCCATGAGGTTGGAACA
CGCAGTTGAACTGCTTCCAGTCAAACAACTCTGTTTCGGGCATTTTTGTGGCTGCAGTTCCAACGACAGCAACGCTTTTGATCCTCAGGTCAGCCGTGTA
CTTCGTATCGAGATGCTTTGCTTGCCCCATCTTCGTCGGGCTGGACAACTCGGTTGCATCCACAAAGTTCTCGTTCCTGATCAACTCAACGTCGAATTTC
AGCTTTCCGAGACGCCCATCGGCTTCTGGGTCGTTTCCTTTCGCTTTTGCTAATTTGCTCTGGCGCAGCTTCTCGTCGCTGAGAAGCATCGCTTCGACTT
CGACTTTGTTCTGGTGATTCAAGTTCAGCGCGCGAGTGGTCGGGTATCCGTTCGCATCGGCGTGGACAAGCATCAAGTCCGTGATGAAACCAGACTTGTC
GCGTTGAAACTCAACTCTGACGCAACCGAGCGGGATCTCGCCGAGTGCCATGTCTTCGTCCAGCACACGCAGAAGAACAGCTTTTTTGTCACTGAGTGTG
CTGTGCTCATCCTTTCCTAGCATGAATTCCTGGTTTACCCATTTGGGATTCACTGTCTTGGGCTTCACGTCTGCCTTCATCAGCGTGTATTCTTCTTTCT
CGTTCTGCTCGCGCAGCAACACGATCTTTACGAATGGGTTGCGCTGAATGAAATCCGCAGGTTGGAGCTTGCGCGCTTCGTGGATCGAGATTTTCAGAAA
CGAGCGCTCTCGAGTGAAGACCGCACCACCTCCGCCACTCGGTAAAGCGGCGCTGCGTTTGGCTCTCGGGTACACGGCATCTTTGAAGAACTTCAACGGG
TTTGATACTAGCGGCTGGAGGATGTTCTGCTTTGCGGCAGCATCTTTCAGTTCGCTGAGAATAGCTGGTGTGTGTTTGCTTCGCACCAATTGGCTGATTT
GATGTAGTCGTAGCTGCACGCGAATCTGACCCAGCTGCATTTTCTGAACCATTTCGTTCTCAGGAGCGAGAGGGTACCAGGCGTCCACCACGCGATGAGG
CGAGACCATCTTGATCGGAATCTTCAAGTACCCCAGCGGCTTCCGTCCACTGGTCTTGATCGCCATCCGTGTGATGCAGTCCTCCAAGTCGTTCGGCTTG
AACAACACGTTCGAATCAGTGCAGCACTCTTCAACTTTTACTAGATCAAGGTCTCCGTCGGTTGTTCGGACGTGCTCGCGCAGCATGCCTTCTTCAATGA
TGGTTTCATTTGAGTGGCGGTACTCAACATCATAGATCAGGAACACATCGCGGAGCATCTTTGGCAGCCGCAGCCACGACGCCTTGTCTTTTACCTTGTA
CTTGCGGAAAAGCTCTACCATCGCATCTGGAACCTCGTTCTTGTCGCTTCGATCGTACAGAACAGCGACGGGGTACTTTGCGTCAGAGTACGGAGTGCGA
ATGCGAACGATCCGACCAGAGTGCAGTGCACCATTCGTGAAGGTCCGCGAGTCCGTCGGCTTCGGGTTCAGTCGCTTTCCTTTGCCAAAGTACGCGAGCA
CCGAATCGCCCACACTTCCAGCTTTCTTCATCTCAGTGCGCAGCTTGGACCGCATCTCGCGCATCTTCTCTTCGTACTCGCGGTGGGACGACTCCAAGTG
ATGTTGAAAGACACGGTTCAAAAGCCGCTGGAAGCTCCCCTCGAGGTCGTTGAGCTGGTACTCGGTCTCGAATTCGATGCACTTCTGGTGAAGAACCTTC
TCGTTGAGACGCTTCATAACCACAAGCTGCCCAACGTGCATGTTCATCTTCACACCCCCATGGGCGAGCGCCTGGACCCACCGCTGTGCCTCCGACGATT
TCAACTCCAGCACTTGGCTTCCATCAGTCTTGGTTTTCAACATCTTTGTCACCTGCTCGTGGTTGACTGGCACGAGCTTCCGTGTACCAGGCTCTTGAAT
GAAAATGGTCGCGTTTGCGATCTCAAACCATCCGCCGTTCGCATCCAGCGCCATGTTGTACGCGACGTGGCATGCAGCGCTGCTCATGTCAATGACCATG
AATGGGAACGACGATGTCTCGGTTTCGTACATGTAGATCGTCAGGTTGCTTGGCAGAAACAAACAGTACTTCCAATCCCAGAGCAGATCTTCATCAAGCA
ACCCCTTTGTTATCTCAACCACTGGCTTCAGAATTGAAGTGGAGACCAGGCTCGAAACCTTGTTATGAGTGCCTAAGAATCCGCCAATATGATTCGTCAG
CTTCTTCGAGAACACTTGCTTGTGCTGCTCAGGCTCTGATGCTGCGCTGGCAGCTGCGGTACCAGTAGACGATCCAGCAATTGGCAGTGACGACGAGTGG
TGCGGTTGCTGGTAACAATCAAGCTCTTGCACTAGGTCCAACGGGAAGAGACTCGTTTCTCGACTTTGCTTTGAGATCCACCGATCGACCTCGCGGAGTC
GATAGTAGTGATCACGTTTGTCCTCCACAACGTAGTAGTTTCGGTTCGTGTCAGAGAAAAATCCACTGGAAGTGGCGTTTTCTATGTAACCAGCGTCACT
CAACGCGCTCAGCCACATGAGAGCTTCTTTGCGAGATCGCGGCGGTTGAATGGCGTCTGGATCTTGAGCGAATTTTGGATCCTCCCAGTGTAGAAGGCAC
GTTGTCTGCTTTGTCGAGTCGTGGCAATATTTCGTCCACTGGTCCTTCCAGAGAACTGGCGGAGCGCGAAGGATCCAGTCAATCATTCCTTCGCCTGTGA
AGCAGTTCGGATACGACAGGAAGAGCGCGCTTGTCCGGGCTTGGACAAAGAAACCTCCAGTTTTTTGCAGAGCTTGTTGACGAACTGTGCGAAGCTTGAC
CCATTCATCACGCTCCAGATCGGCAGCAGGGTACACCCGTGGGAGGTCCGAGCCAGACAAATCCAGTAGCTCCATCTCAAGGTGCAAGACAATGTCTTTC
CTTGTCTCGACCTTCATCTCGTTGATCATCCGACCGAGCCACTCGCTGTTTGGGTCCGCGTTGGTCGTGTGGGTGTGACGAAACTTTGCCATATCTGCAC
TTGAGAGCATTTCAAACTGCTCAAAGAGCTGGATCTCACGCAGGATACTCACGATCCTTTTCAAAACAGCCACGAGCACAACGTGGAAGGCATCGATCTG
TGCATTCTCCGTTGGCGTCAACGACGACCGAAGCACCTCTCGACGCTCGATTCGGCTTAGAACGCGAGTCGGAGCTGTCAGCGAAGACGAATGAACTTGA
GCTCCCAGGCGGCGTTCATACCACTGGTGAAGTCCGCACACCGTAGCTTCATTGTTTTGATCATCCGAAGTTCTTTGTTGATCGATTTTGTCAAGTTTCG
CATCGTTTTGCTTTGCCGCGTCCACGCAAGCAACGTGGAGGTTTACCGTTCCGACGAACTTGTAGTACGGAGTCTTCTCATCCGGAACCAGCTTCATGCG
CAACATTTGCTCACCATCACGAAGAGCAGCCAAGTCAAGCTTGACGAATCCAATAATTCGATGATTGGACAAAGGTTTCTCGTTCTTACCCTGGTCAACA
ACCTTGATCAAAATACTGGAGACGTGCGTCAGGATGTCGACTGCGTCGTCGAGTAGTTCCTGTTCCGAGTCCATCGTCATCGCTCGGTCATCACCTGATT
CTTTTTCACGGATATCGCCAAAAGAAATCGACTTGTTCTCAAAGTAGTACATTTCGTTCACGTCCGCGTTGGCCGATCCGTGGGAAACCGACAGCTCGTA
CGGCTTCCCAACCTCCCACTCAAAGCCAGCGATCGACTTTTTCGCCACCATCTTTCCGTCAGAGAGCACGGTGAAAATGTTTCTCGATGAAGCCGAGACG
CTGGGATTCCCTATAAGGGTAATCAAGCACCCGGGATGTGTGATTTCCTTCGGTAAACCCGACACTGACAGAACTTCCATCTTGAGTGCTGAGAGCGAAT
GCTTGAGGTGCTTCCATCGAGCGGTTTCTGCGTCCTCTTTCTTGATGCGCCTGGCGAGTGTTTTCTCTACTAGAGAAAACGATTGCACGGGAGTAAGTAG
TGAGACTGGGACAGCGTGCACGTACTGATCACCAATGTCTTCTTTCTCCATCAATAATACGTCAGCGCTCCCGTCGGCGCGAAGAGATTTGATCTTCCCC
TTCACGTCGAGTGAGAAAATGTTTCGAATGTCCTCGACTGTCTCCATAGTGCCTTCAAAGAGCACCAGGTACTCGTCCTTTGGGAATGGAAAGTACTGCT
GCACACGAGCGGGGAAGAACCGACCTCCATTCTGGCACTTGCGGAACGCCAATACACGCTGGTCATATCGGAGAACCTCGAATCCATCATCGTCAACTTC
ACCTGATGGAGCCATTTTATGCAGCTGGTGCCTCTTGAGATGAGCTTCCTGGCTATTCTGTCCAAGCAGGAGCGACAGTGGGGTGGTCACTTCATCCGGC
AAGCTTCGCGTGTACACGTGAAGCGAGAGATGCGAGATGGTCGAGATGTCTTTGATCTTCCCAAAGACAAACTCTTGCTCTGGCCAGCGCGGGTTTCGAG
TACCGTAAACGGTCAATCCCTGCTTCTTCTCACCAAATTCCAGCTCGCCACTTCCCAGGACTGGAATGACCGTAAAGTACGCGTTTGTACTCGCCGGACG
ACTGAATCGGTGGTGGTTAAACTGGTACTCACCTGCCTCGTTTACTGATTTCGCGCTACTCCGTTTTGCTGCAACGTCCTGCGCGCCGAGCAGATTACGA
GCGCTGAACACGCGCAAGTGCAGCGTGTAGTGTTCAATCTTGTCCGTCTTCGCACTGTCGCTGAACATACCAGGATACGACAGCGACAACTGGAATTTCT
CTTTTCTCCACTTGGCTTTGTTTCCAATCACCGTCGCAGTCCGGATCTCCTTGCCACGCTCCAGCACTTCCGTCACTTCGTCTTCGTACTCAGGAAGAGA
CTCCAAATTGGTAGAGGAGCCCATCACCTCCGACAACTGGTTGCCTTGCATGTACGGGTCTGTCGTAAAAGACGAAAACGACAAAAAGCTCAGCATTTTC
TCCGGCGAGTTCTTAGGCATTCGCTGCAGCAATTCAGCGAGTACGGTGGCGTCTCCAACGACTTCGGTCTTGATACACAGCTCGCCGAGATTTTGCGCGT
GCTTCTTCATCCAAGGTTCCGGCATCAGCGGGTAGCGCTTTTGTTGTGATCTTGACGCGATCGATGTCGAGGTTGCCGACGCACGACACAATTCATACAG
TGGGATCTGGACGCGACCGAGAGGCGTGCTTCGTCCGAGGTTGTTGTGGTCCTTTACGTGAACCAGGAGCATTCCCGAGTCGCTCAGAGGGTGATTCTAC
CAGACAAAATTAACGAAGAGAGAGGAGCATAGTATCAGCGGCTGTCTGCTTCAATCAGGTTGAACACCAACTTACATTGCCGAAGATGAAAACCTCGTTT
TCCCAGACTGGGTTCAGCGTTCGTGAATGCATCGCAGTCTTCTTCTTTTCACTCTCGACTGGCTTGCCTGTTACTCGATCGGTGACCGTGAGTGTGCAGT
AAGGATCACTGTATCCGCCTCTGTCAACTCCACTCAGACCGTGGCCGCTGATGACCTCCACTCTCAAGCATGGACGATCAGGGTTGACCTCCAAGGCTCT
TTCAGAGCGAACTTCATTCTTGACGAGTTTTGTACGGGTTGTTGAAACTTCGGCATTAACGCGCTTTGAAAGCATCGTGTTTCGTGAATCAGCGGCAGCC
GTATTCAGTGCTTCAATCCGCTTGCTCTTCTGTGGCGATAACGGCGCACTCGTCCTTTTGCACTCCTCAACGCACACAGCTGGCGTCACTTCAATCACGG
CGTACGGATTCGAGCCTGCGAGCAAGTCTGTTCGCATGCCCTCACCTGCTACCGTCACTTCAACCACGGTGACTTCGAGCAGAGCTTGGCCTTCAAGTCC
TGCTCGAGCCTGGAAGCCTTCGTCCGATGACTTGGTTTCTTGGTGCGCCTTCGGAATTTGCGTACTCAGCTCGTGGATGCATCCATTGATACCATAGAAC
CGAGGGTCACGTGCAGTGTAATCGTTCACAGCGCATGCGATGCGCGCACCGTCGAGCTTACAGGCAGCGTCGTGGAGCTCATACTGTGCATTCTCCAGCT
CTAGCTGTTCAACCGACTGCTCGTGCGTTTTCGCGGTGACTTCTTTGTGGATCTTGAGTCGCCTGGCGCGTTCTCCTCGACTTTCACCGAACAGCGCGAG
CTTCAGCTGGATCGAGCCCAGGTTTTCATGGATCGCCATCCCTGGCTCCGGCTGTAACTCGTACCACACGGCAGCATTGGACACCGAGATCTGATCCAAG
TCGATTACAGCGCCACCGAGGGGATCATTCTTGCTGTGCTTGTCCCAGTCCATAACTCGAACTTTCAGCTTCGCCGCTTGGTCAATCGTCGAGAGCATAC
CAAAGATGCAATGCTCCTTCTCCCACGTCGGGTTGCGTGTCTTATACTTGATGCTAGTAGTGTGCGATTCGCCTCGAATGGGCTTGCCATGAGTGTCTAA
GAGCGTGAACTCGCAGAACGGATCCGACGAGTTGTTGAAGTCTGCACTGATAAGGTCCTTCGCAGCCAAGACTGTCAGCTCCAGACGGTTGTCAGAGTGT
TCGACGCCTTCGTTCACAATGCGATTGCGCGGGCCGAGCGCTAGATTGATGCTTTGAAAGAAGTTCACGAGATTTGGACCCACAACGCTCATGATCAGGT
GGAGGTCTCCATACTCCTTGAGCATCTCTTGCTTCTCTGGAGCTACTTGCCGAGGCGACGTGGACGTTTTCTGAGGCGGCTCAAGACGAAACCATTTATC
AACCAACTCCGACTGACCAGTACTGGCAGGGGACATGTGGAACGTCGACAATGGCACTTGGACAAACCCAAGCGAGGTATCTCTTGAAAAGTGGTCGTGG
TCCCATACCTCAAAGTGCACGGCATCGACATTGTGAAGGTCGACTGCATTCCCGATCTTGAACTTGGCGTTCCACTCGGGGTTCAGATTGCTCGTGACGT
AGCTGGTTTTCATCTCCTCGCTTCGAATGAGCTCTCCATTTTTCCCGACGAGATTCACGACACAGAACGGATCGCTCTTGCCATCGAAATCTGCCGATCG
AAGATTCCGAGCGCCTTGAATCGTCAGGTGAAGCAGCACGCGCTTTGGTGATTCTGGATGAGCCAGCCCCGCTGGAAACGGTGGAGGAGGAACAACTACG
CGAGTAGGAGACGGCGGAGGAGGAGATGCGACGTTCTGCGACCGTCTCGCGGCGTCGAAGATCGCGGTGCTCCACTCTTCCTTCTCCTTCTCGTTTTCTG
TTTGTAGGTAGAAATTGTCCTCGGCTGCTGACGCCTTCACGACAAAGCAGAGCGCGTACCCTTCGTCATTCGTGATTTGCACCAGCGAGTCATGGCCGAG
CACGACCCGGCGGCGCACCGCTGTGTCTGTCGGACTTAGACTGTACACGAGCTCATTCGCATAGAGCTTGAAGTATCGGCGCTGCCATTTCCTCAGAGCT
GGAACTGCGTTGCGACTGCGCTTTTTTAAGAAGCCCTCTTTGAGCACCTCACGGCGCGAGTCCGCCATGCTTCACTTGGCTCCACCTCAGCCTCTCACTC
AGCCTCACAGTTGGATCGAAATGGCAATCTTCCGTCTTCTTCGTCTTCCTCGCCGCTGCGGTTGCTGCTGTGCGTGCCATACACCCAGGCGGAGAAATTG
AAGAGTGACCGCCCGAGATCTTGCGCGGTTGCGAAAAGTCGTCTTCACGCGGCCGCTCGCGACAAACCGGCCCGACGTTCCACGTACGACTCGCTGGTAA
TTACGCATATTTACCACTACCTGCTCACCAGACAAAAAACGTAACCACTTGTGCGGATCCAATCTGTTTGTTGCTGTAGCACGCTTGTGTCCTTTGCTGC
TTGTTCTTGTGATTTGTGGCTTCATACGAGAGCGCGACAGCGTCCTAGAGGCTCATTTTTTGGCCATTTCAGCGGATGTCACTCGCACACGAGAGACAGG
CAAATGCCGAGCTGCTTGTTATCTTCATTTCTTCTTTTGGTGCTTTGGCTTTTGGAAAAAAAGCGGAGGGGGAAGATCGCGAGAAAAGACAACTTTCTCG
AAAGCGGAATGGAGACTTGCTGCACCCTTTCGCTGCTCTTTGACATGGTGGCGGTAAGAACTTGGCGGCGAACGAGAGTAGCGAGCTGGAGAAGATCCCA
GAGGATACTCATCCAAGGATTTTTTGGCGTGCTTCCTCTGTGACTCGATGTGGATTGCAGGATATACCTGACAATTGCCTCTTGACACTGTTCTTGGAAC
TGAATGAACTGCAGAGCCAGCCTCTTCAGCAGTGAGGCGGTCTTCGTCGCACTGGACTGCCATGTTGGTCTTCTGAGCTACCGACCAAACAGCTTTCTCG
GCTTTGAGACCGACACCATTGTCTACACTTGAAAACTCGATGTCACTTCCAGTTTTGGCACGCTCAATGCCCACTTTGCATGACTTCCAAGACTCGCGTT
GATCGTCGCAGTCATCTGGCGCTCCACTTGGAGCGTGAATTGAAACGAGAGAGTCCTGGAGGGAGCACCTTGGTTGAATTGACGGCGACACTGCTTTCTC
CACCTGCAGCCCAATCGCATTGACGATGTGCGGTGCGAGGGTCCGACCGAGACACGAAAGTGTTGCTGCCCCCGTCGCGACTCCGATCACTCGGCTCTGG
TGATCGCGCAGCTCCCAGTTCCCGCTGCTGCTTGCCCACTCACAGACCCGAAAGCGCATCTCTTTGTTCAACGCTGCGGTATCCTCGCTACCTCCAGTTT
TGCTGAGAAGCCCGACGTGGAGCTCGATGGGGATACTCGCAAACGCCACGAGCCGCGCTTTCCCGTGGTCCTGCTGCATGATCAGCAATGCCAGGGGAGC
GTCGCGCTCTCGCTGCAGGTCGACCGCCAGATCTTTTGCGTCGGCTTCAAAGAGACACGAGTTGCCGTGCTGGGGCTTCAACACAACTCGTCGCGGTTGC
GGCCGCTGGATTTCCTCATCTCGGTGGACGCCATCGCTGCTTTCTACGTCTGCAACCTCCTTGCCGTCGTCCAATACTGTGTGCTCATCATTCGCAGCAG
AAGCCACCGCGTCAAAGAGCACGATCTCGTACTGCAGCAGCTGGAAGCCGATCAGGAAACTACCACTCGCACTCGCCTGTGCACTCTTCATCTTGTCGCT
GGTCGGCTCGGGCAATCCCAGCTCAACGCTGTTGAGAAAGAACTGCAGAGAGAACAGCAGCAGTAGAGTGGAGTCACTACATTCGTCAGTAGTCCGCGAC
GTCAGGTGCTGATCACATGGCGCTGTCATGGCCGTTGCGTTCCTCGCAGCACTTGCCGTCTCCATCATTCGATGCATTTCCAGCTTTTGTTTCGTTGATC
TTTAAACATTCCCGCCAAGAGCAAAAAAACGGAAATAATTGAATTTAAATTGTAAGTGATGCTACATAAATACAGACCAAAATCCGTTTAGAAGAGACAA
CGAACCATCCAAAATATCGGATAAGGAGCGCCTAAAGCTGGGTAAACGGATGCTTCAAAGCTTTTGCAGCCGCACGATCCGTTTGCGAATCAACAAGATC
AGACAGAAGAAAGATGCTGACGATATCTTCGCTGCAGACGGCGCTGCGTGGCGCCACCGCCGCCGCCATCCACGCGCGCTTCTTCAGCGCGGATGCGGCG
CACCGCCTCGTCCAGCAGCGTGTGCAGGGCCAGATCGCGCTCCTGTCTGCGCAGCAGGAGAACATGCTGCCGTCTACGACCCGCGTGCTCTTCGTGACCA
AGTCGGAGGACGGCCACGGCGCGGACATCCACACGTCTGCACTGCCGTTCCCAGTGTCCAAGCACGCGTTGCAGGACTTCCACGCCAAGGCCCAGGAGAA
GATTTATCTGTACTCGAGCTCGGACGACGACAAGTACGCGAACGAGCGCGTGCTCCTGGTCGGACTCGGCGCCGCGGAGAAAGTAGACGAGGACGTGCTG
CGCAACGCCACGCACGGCGCGCTGAACGCACTGAAGGCGAAGCGCGCCAAGGCCGTCGTGCTGCATGTGCCAGAGCTCAAACAGTCCAAGCTCAAGCAGG
AGCGCGTCGTGGAGCTCTTCTCGCAGGTAAGATGCAACTGACTTTTCATCATTCTTTTGTCTGTGACAGGGAACAGGATTGGAATCCAAACGCTTTTTGC
ATGTGATACTGGAAAAACCTGTTAGGCTTCAATTCTTTCCAACTACCAGTTCGACAAGTACCTGACCGCTGACAAGGACGAGAACGGTGAGGAGAAGCTC
AAGCTGCCGCTGGAGAAGATCTACTTGGAGGCTGGCGCGGAGTTCCAAAAGGTGCGCTTGAGTAGATATCTTTGTTTGTAGCGTGTCTACAAGGTTGCGA
TAAAACTCATACGTATCTTTGTTGAACCCGCTTTACGCAGAATGTGGCAGAGCAAATCACGGTCGGCGAAGAGACGATCTTTGCGCGCAATCTCGGCAAC
GAGCGATCGGACGTGATGAACCCTGCGTTCATGGAGGAAGTGGCTCGCGCGTCCGCGAATTTGCCCAACATGACGGTGCGCGTCATCCAGCGCGACGAGC
TCGAACAGGAGGGGATGAACATGTTCTTGAGCGTCGGCCAGGCCGCGACGTACCCTCCGCGCCTCGTGATCCTCGAGTACCGCGGCAACCCGGATTCGGA
CGAGAAAGTGGCATTGGTCGGGAAGGGCATCACGTTCGACACGGGCGGCTTGAACCTGAAACCGAGCGGCTTCATCGAAGACATGCACACCGACATGTGC
GGCTCGGCGGCGGTGCTCGGCGCTGTGCGTGCGGCATCGCGCCTCGGACTCAAGGTGAACATTGTGTGTGCGCTGGCGATGGCAGAGAACGCTATCGGCT
CCAAGGCGGTGAAGCCGCACACGATCGTCAAGTCTCACAAAGTAAGAGAGAAAGAGCCCTGTTTGAGGCAAAGTTCCTCGGTGATTGCGTTTTAACCAAC
CAAAACTGTTCTTGTGTAAATTTCTAGGGCATTACTGTGGAGAACAACAACACGGATGCCGAGGGGCGACTCGTGTTGGGCGACACGCTGTCGTACGTGC
AACAGCAGTACAAGCCAAAGAAGGTGATCGATGTGGCGACGCTGACAGGCGCTTGTATCGGTACGAAAAAGACATGAGTCTAGGCTTCTATACGTGCTCT
CCTATGGAGTCTGACGGTGCTGACTGTTGTCGTGTATGATGGTATCCTCGTGGTCAGTTGCATTGGGCGAACACTGTGCCGGTGTCTTCTCGAACTCGGA
CGAACTCGCTAACAAGCTCCAGGTATAGAAAACTCGTTACAGCATGCATGCTGAGCGAGGAAATAAACTATTGAATTGTCGTTATCTGAGTATTGCCTAC
TTTGTACTGTGTGATATGCTGTCGCTGCCAGGAATCGGGCACGATCTCGTATGAGCGCTGCTGGCGCTTGCCGATTCTTCCGGAGCACTCGGCGGAGCTC
AAGGGGTCGCAGTCGGACTCGCGCAGCACGGGCAAAGGGCGCTATGGCGGCGCATGCACTGCCGCGGCGTTCCTCAAGCAGTTCATCGACAAGGACGTGG
ACTGGGCGCACATCGACATTGCTGGTTCGTTCGGTTTTGTGTGTAGATTCCTTTTGGTGAGAATTCTGGCTTACAATGTATGTTTTCTTAATCTTGAATG
CCTGTCAACTAGGTCCATCCAACTACAGCGCGCCAAAGTCGTACTTCCCAAAGGGGGCCACTGGCTTTGGTGTCCAGCTTCTCTACACGTACCTGAAGAA
CCACGAGCACCAGCAGTAAAGGA