Description :
From Genome Similarity Track
Location :
Scaffold_52:8716- 10306
Sequence
1590 bases(100 bases per row)
TACCAATTTGCAAGCCTTCGGAAATAAACACGTGTAACGCTATTATATTAATTATGCAAGGTTCAAGTGTCCCACGATCCTACCAAGCCCCAGCCGTAGA
GCAGATGTTACGATATTGACTGTCCCTACAAATGCGTGGAATCGAGACTTTTTAGCGGCTTCGTCCGACCACCGAGCGACAACGAATTGTGACAAAGCAC
GTCACGGCATATCTGTTGACTAAGGCTGCATGCATCTGCAAACGTTTTTGACGCTCACTCCGTTTTAGCCAAGCCAAGCCAAGCACACGGATTGTTGAGA
TGAACAAAAGGCTGTCGCTCTCAGCCTATTTGATCTGGCAGCGAGAGCGCTTAAATATATATAGTTTACCCAATTTCGTCAACAACATGACAGCTGCCTC
TCTCTCTATCCATAATGCTTAAAATGGCCGCATAGTAGTTTTTACACACTTATGTAGCAGTTATGTATCTGAGAAATTACCCCGCATCGGGGGTTTTCAC
GATCCTTACAAATAGCAAGAGGTTTTTCTCGCCAGCCGCTCATCGCGGCCATCTCTCTCTACCGACCACTTGTGGCACAAGCAGAAGCACAGCCAACACG
ACAACCCGCAGACACCGATGCCGCCGAGTGTAAACCTTGTCAAGTTCTGGGTCAAGTTCGGCCCCGAGTTCGGCCGTACCTCGCGCCACTTGTCGCCTTA
TGAAGTGCACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN