Description :
From Genome Similarity Track
Location :
Scaffold_40:87132- 89569
Sequence
2437 bases(100 bases per row)
AAGGCATTTATTGGTTGAAAGTCAATATCTTCAACCAATTAGAATAATAGGATTCTGTCAACCATTCGTTGATAAATACCTTTCATTTAGAAAATTAGGT
TAGGAGGAAAAACCCAAACAGACAAATAAACAAGTCTCATTTTTGCCGGAAATCGGCTTTGCTCTCATATTAAAATAAATCTGTACTTTCGGACGAAAAT
GTAGTTGATCTAAGTGAAACGCAACTTACGCTTCCTCATACACGTGCGCTAACGTGTGAGCCGAATTAATGAGCTTAAAGTAGGTCCACTACACCTGGTA
GTACTTTGTAGTCCGTCCGACGACCGACAAGCTAACGTGTTCGTTTGAAATACGAACATGGGGCGGAGAACCAGCCCATGAACAGTAACCCGTCCATGCG
TAGCCTATTCGCTTCTGCCACGCACTTCGTGCGTACAGACTGTCCCCATCTGTCGGTTCCAGAGTGGAAAGCTCTTCAAAGACTGCCAACAGTCATTGGA
GAGGCAGCCGTAGCGGCAGTGCTATGTACGATATCGCTGACAGAGCAACAAGGTGTTTCTCTAAGATTCATCATGAGCGAGCAGCGCGATGCTGCTGCTG
CTACAAAAGTGTCGCCCGGGACGGCACCGCGCGTTCAGTCGTTGAAACTGCACGTGAGTCATTATGTGGGAAAAGAGGGCGAGCCTCTTCTCCGATGGCT
TGTCTATATCACTGACGAACCGTTGAACGTTGTGTTCACCACGTCATACCTTAGCGGACGAGCGAGGAGCTGGGTGTATGGCCGTCGGCTCACAGATCAT
ACGTGCTAAAGCACGTATGCGATGTTCAAGAAGGAGCTCAGATAAGCGTTTGATCCCAAAATGAGTTCCAGTCGAGAGCAGCGTTTCTCGACCTGCAGCG
AGGTAAGTATGGCGCTCATGCTTACGCCCAACGTGCGCGGTACTTGGTCTCGAACATCCTGACCAACCCGGTCGACAAAGTGACAAAAGTCGTCACGTTC
ATGAAGGGCTTGGAGGATGGGTCGGTTAAGACCTATTTCTTCCGAGAGTACACAATTGCTCTCGAAGCTGCGATTGCTCCTGCGATGCAAGAGAAGTTTA
GCCTGAAGCAGGCTAAGCTGCATGTGAACATGCTAAGAATAGGACGTCCAATGAGAGCAGGAGGCCCAGAACCTATGGATCTCTCAAATGCTCCTGCTGT
TGAACGCCAACAGCGTATTGGAAGACAAGTGCGGTGTTTCCGATGTGGGTACACCAGACACTTTGCACGAGAGTGCACAGCACCTGTGCACTTGACCAGG
GGCCAACGTGGCGATCCCGGGCATCGCCGCGTACAATAATAAAAACGTGCAGAACCAGTAGGCGCGGGGGCGCCCTACTGGTATTGCAGTCGCGCGTGTC
TACAACGGACACGCGACACTGAGGACTGCAGCCCCAGCGAAAGAGATCCAAGGTGCAAGAAGCAAGATGACAGGCCAAATCATGTCACCCTGAAAGCGAC
GTCGAAGAGGGTAGGCTCTCTTCGTGCTTTGGTTGACTCAGGTGCGTCGAGCAACTTTGTTCGACTGGAAAGTCTCCCGAAGCTGAACTTCGAGGAAGTT
AAAACACCTCAAGGTGTTTTGGAGGTGCGGTTGGCAACAGGTGCCACCGTAAGAACGGAGAAGCGCGTAGTACGTGTGCGCTTCTCGTACAAACACCGGG
TGTTTGTGGAAGATCTCATTGTCCTGGAGCTGGACGATAAGCTTGACTTGGTATTGGGCATGCTGTGGCTTGCGCGGCATGATAAAGTGATCAACTGGGA
GAAGTGTACACTTGTACACTTCGGACGCACCGCAACAGAGCGCGATGGCCCTGTCAGTGTCGCACATGCACCGCGAGGTGCATCCGATCCCACCGCCGAG
GCAACACCTTACGCTGCAGCCTCCGGTGCCCATTCTCAAGTCGCAACGACTGAGGTAGTCGTTGAATCTGTCTCAAATCGAAAATCAGATCTAAGACACG
TTCATACCTTAATGACCGTGTCAACTCGGGAAGGTGATCGATCAAACTATGAAAGAACTTCAAATCACAGGCAATGGCTGCGTCGGTCCCGGGGACTGAC
ACATCAGATATGCAGGGAACACCAGCTAGAGACAGTAGCTGTGATCTCGGCGTGCCAGCTCAGGGAGTTGACACGGTCGTGATTGGTTCAAAAAGACCTA
AGGGCTCCACCGAAAGGCGTCGAGGTAACAAGGACGTGTCAACTCCGGGAGTCGACACAAATTCGATATCAACATCGAGAGGGGCCCCACCGAAAGGCGT
CGAGATGATAACATCGCGTCAAGAAGTGTTGGCGGTTGCAAACGTCCAACACTGAAAACGCTTGCGTGCTGCGTACAGCCGGGCTGTACGACGAAGTGGA
ATGCAATCAAGCCGGGCTTGATCATTGGCGTCCGCGG