Description :
From Genome Similarity Track
Location :
contig_3:871107- 872187
Transcript NameFunction/comments
g943.t1AGC protein kinase

Sequence
1080 bases(100 bases per row)
GTGCAGCACAACTCGGTGTCGTACTTGCAGGCGGAGAGGGACATTATGACCAAGATCAACCACCCGTTCCTCATCAGTCTGAGATACGCGTTCCAGACCA
AGTCGAATGTGTATCTGGTCATGCCGTTCGTGGCGGGAGGAGAGCTGTTCCACCACCTGCACAAGGAAGGCCTGCTGCTGGAGAGCTCAGCCAAGTTCTA
CGCTGCCGAGATGGTGCTGGCGCTCGAGCACTTGCACTCACAGGGTATCATTCATCGGTAAGGTTGCTGTGCTCGCCTTGTGGTAGGCGACGGTGAACTC
CATTATGCCTCTCTTGTCTTGTTGTCAGAGACCTGAAGCCGGAAAACGTGCTGCTTGGCGCCGACGGACACATTCGGCTCACGGACTTCGGCCTCGCCAA
AGAAATGGCAGACGTGAGTTGAAGCTGCACCACTGGAACGGCTGGTGTCGTGCTAATTAGCTCCATGGGATGTTGCAGGAGGATGATTCGACGAACACCA
TGTGCGGCACGAACGGTAAGCACCATGTGTCCATCCTGCAGTGCAATCGGTTCCTGATGTGAGGGTTTGCTGCTGCACTAGAGTACATGCCGCCGGAAAT
GATTCGTCGGAAGGCATACAACCAGGCGGTCGACTGGTGGGCACTCGGCGCACTCATCTACGAGATGGTGACGGGCTACCCGCCATTCAGACACAGGAAC
CGCAAGAAGCTTCACCACAAGATTCTAAATGAAAAGGTATGGAAATGTTCAGTTGCCTTTACTAACCGATTCGCCCTATTGTTTTGACACTAACTTTAAT
GGGCCCTATCCAACCCGCGTTTGGCAGCTTCCCCTCCCGAAGTGGCTTGGGAATGACACCCATTCGATCTTGAAGCAGCTACTGGAGCGAAATGTCGACA
AGCGACTGGGCTCCGGCAAGTCAACTATGTTCCAGGTGAAAGGTGTGCAGGCCATCAAGAAGCACGCCTTTTTCAAGGACATTGACTGGCAGCTGCTCGA
ACAGAAGAAGATCCAGCCGCCGATCCTGCCCAATGTTATGAGCAACACGGACACCACGTACTTCTCGGAGGAGTTCACGA