Description :
From Genome Similarity Track
Location :
Scaffold_2238:871- 3328
Sequence
2457 bases(100 bases per row)
GTCTCGTAAGTAGTCTTCGCTTAAAGCAGCTAGGTACCTAGCCCATCAATCtccaggagaagctggatcATAGTACACCAAGAGGATAGCAAAATGATGC
CTCAGTTGGCCAGGCATTTGGAAGAAGTTGCCTCGCAGAGGCACCGATGGTTCTCCTCGTCAGACTCAAGAAGGCCCACGGCTAGGACCTCCTCCTTAAA
CGTCGCATGAAGCTCTCCATCAACAGTTCTGAGGTCGTCAAAAGATCTGAGTCCGCGGCGATAGCATAGTAAAATTCGGATATAGAATCGGTTCGTGTCT
CGAGGAGAAACTGAGATCATTCGACCAATCGCCTTGTCTCCACTCAGCGACCGCGTCACCTACCTATTCCGTGAATCATTTTGTTTCAGACGAAATGGAT
AGGCATCTCATGATAAAGAAGTTAGCGCGCAGTAGACCCCTCCGGAGAATCGATGCATCACAACTAACAATGCAGTCAGCATCGTGAACTGGTTGAGTTC
AAGAACATCCTGGAGCcttgcagtcgtcgagcagcgagtcATTTGTTTGCCTTCTTCATGAACGGATAATCGATGGACGTGGTGCGACTACTTCTGCATG
TCGTACTTGAAAATGGCCCAACACGATTTCGGGGGCGACAAATAGCGAGTGTCGAGGTACTGCTGAATTTCATCGACAGGCTCCTCCGCAACGTTGTGTC
ATTAGCTCCACCGCCTCTCCTCTCTGACCCCGAGCTCTCAGCGCTCTGTCGCACGATCCTGTCCCTTGTACACGTACTTGTACTTATACAGATTGCACCG
TAGAGTAGATCTCCACGTTAACATGGCATTTGTATTTTTTGACAAAGATATGGGCCATAAGCAACCATCCATCGATTGTCCACCACAACCACCTCGCGCC
TAGACTCTGGATCGTTGCGGCGCGGGTTTCAATTCTTCTTAGACACGAATCGCACTGATGTAGCCCTCTGTGGTCCCATGGGAAGGTTAGGATCGACGGG
TCCAGGCCTACGTCGACGGTACACGGAGTAGCCATCTCCATCCACGCGGGTCTCATCAACAAAGTCCCTCGGAAACCGCTTGGAGCATTTCACGTCATCT
CCAACGCAGGGGCAGTTGATGCCTTCTCCACATGGTCCATGAATCATGCATGTTGAAATAGTCTCGAACAGTTCTAGATGAGTCTCCCGACCCGGTATTT
CCGCACAAACATATCTGTGTAATCTGCAAAAGTTCTCGGCTTTGATTGACCTTTTAGAACTACCAATATGTGTGCGTGAGGCCATCCCGGCTTCTGGAAT
TCAATCACGTACACATAGGCTTGCATCTCCCCGAacacgcgcttcttcgtAATGTCGTCCATGATAGCCTTCAATTTCATCTTAAATACACGCGTCACTA
TGGCAGGGCGATCGGATGCAGTTTGGCTAGGAAGCAGATTATCTTGAATCTATGCCACTTCGGATTGGTAGTCACAGTGATGAACAGGTCTGGTTTTGCA
AACTGCCGAATAATTGCCATTGAGTCGTAGTATTGTTGGCGCATGTAACGCACACCACCGGGAAACTTGGATGATAGGATGATGTGGTGCTAGTTTCTTG
CACGTCCGGGACCGAACGCGTCAATACGTGGTCAGCAAGCATCAATTCCTGCAAGCCGGAAAACAACTCTCTGCGGTAGAGTCGTTGAGTGTTCAGTCGT
CGTTGGAAGCATAGCCTCTGATCAATGATTTTAGCGGCTTGGTCCACACACCATTGCTGCATCAATCGGCCGgctcgacgaagcagagaGTAGTCCACAT
CTTCGTGCTTCATATAGAGTCGGAAAGCCGTGTGTTCGCGAATACTGACCTTGGAGGTTTTGTTCCGCTGAACCCCTTTGATGTACCGCGCGTGCGTCGA
CCACCCAATTTCGCCACGTAAGTAGATGCGCGGGTACTGGGGAGGATCACTACAGCGGATGTTTTTCGAAAATACGGCGCAAAATTCCTTGACGGTACCG
CAAGACGACATTTCTATGCGATGCCGTAGGGCCGCCGCATCCCCCGCTGTAGGTCGATTGTAACGGCGAGGGTCTACGCGCAAGTTATCCAGGAGTACCA
AACACATCTCCTGACTGTCCTGGGCGTACTCGCGGGCACTTTGGTACATCTCCGCCAGTGGGTTGATCTCGTGTAAATGGTTTTTGAAGCTCACCAAGAA
TAGTGAGGTTCGACCCCGACGAAATCGCCATACCTCTAAAAGCAACTTCCTCCTCCGTAGTTCCGTCGTACACATAGATTTGAACGAACGTCGGGTTAGG
CCCCTCTGGCGGAAGTAATTGCACAATGCGATGATGCATAGCTTGATTAACCCGAAAGATGTAAGGTGCATTGCCTCGGTTATTTTTTTGTTATTTGAAT
AGTCCTCCTTAGCGTCAGCGGAagtgaaggcgaaggcgctgTTGTACTCTCTGATCT