Description :
From Genome Similarity Track
Location :
contig_87:87090- 88813
Transcript NameFunction/comments
g12405.t1RAW26373.1 hypothetical protein PC110_g17228 [Phytophthora cactorum

Sequence
1723 bases(100 bases per row)
TCTATGGCAGCGGCGACAGGACGACGAGGGGCAAAGGGTTCTCAATTCGAGACTCAGCGAGTCAGCAAGTGCAAAGGCAAATCTGAGAGAGCGAGCAGAA
CCCCGAAGAGACCGGAGACAAGTTTCGGACTGCCGTGTGCATGTGTCGGAATCGTCATCGTATCAAGCGATGCCTGCTTCGAAAGCAGCTAGTTGCCGCA
AGTTGCGCTTTTCACAGGTGGCTCAAGTGTTTGATGCAGCCAGGCGCCTCGCGCGTATCTGCGGCGCTAACGATTGCAGAAAAAGAGTTCACATCGTGTT
GTTGCTCGCGAGAGGGTCATCACCACCAACCGAGAGGAAGGATCGAGGCTTTGGTCCGCCAAGAGGGAAGTGTAGCTATCTGTTTCCCATAAACAAAAAC
TGAGCCGGAAAAAAAATTGTTCTCGAATTTTCGGCTACTCAACTTCAACCAATGTGTCCTCCACATGTCCTCCTCGTCGACCAGTGAAGGACAACAGCCG
ACCGCTCTGCAACCTTGGCAAGTTGCAGGCGGTCTGGCAGCGTGGGATGACTGCAAGAGCGTCGAGGAGCTCCGATAACGCGAGTGCAAGCGGAAGGATG
CTTTCACTGTGGACGAACGGAGTCTCTCGCGCCTTTGTGGCTTGCATCTCGGCGTTGTGAGGCTTGGCATCGCATATCCATCTGTCGACCACCGCGGTCT
CTGGTCGATCGCCGAGTTGAAGCGCTGGAGCGCCAGCTTCAACGCCAGAGACGCCATGGGCCTCTCTTGCATTCGACTGAAGCTGGCAAAGATTCTCGGC
CCACCGAGTGATGGGAACGCCAAGATAGCTGCAACATTCAAATAGTGAAGGTGAGTAATTGCAGATGGCTGTGGTTTGTTTTGGGTTGTCGCTTGCGGCA
GAGGCAGAGAGTTCAGAATGTGAGGAAGAGAGCGAGGGGGCGCGGGTTGCTGCGGCGGTTCGCGGCCACTTCTCGCTTGGCCGCTCAATCCAAAGGCCAT
GAACAAGGAGAACGCCAAGGTGCGCGGCAACCAGCGCAAGCTCACGTTCCACCGCCGCAAGAAGCCCAGCGCGCTGCAGATCGACCCCAATGCGGCGCCC
ACGCGCACGAGCACCTTCTTCGGCACGGTGGGCTCGCCCATCAAAATGGGGCCAGCCCACGGCGCGGCCGGGGCCGGGGCCCGTCGCGTGCCAAAACTGC
CGCCCGGCCCACGCCGGACGCGCCCGTGGACTCGGAGGCCGCCACGCTCGACATCAACCAGAAGGCGGCCTTCAGAGAGGAGCTGCGCCGCCAGCAGAAG
GCCAAACAGCGTGCTGAGCGGGCCACGCCGCCGGCCGAGCAGCCCGAACCCAAAGAGGACGAGGCCGGCGTGGCCACGGTGCGCAACGACGCCGGCCGCA
AGAACCGCGGCCGCCGCAACTCGACCGAGTTCCTGGGCCAGACCATGGAGCCCGTGCAGCAGCTCAAGCTGGACGGAGCCAAAAAGGCCAAGATCCCGCA
CTTCCTCTCGGCCTGGTTCAATGCCGGCCACGACACCAAAGCCACGAACGACACGGACAATAGCGACGCCGAGTCGGCCAAGACCGACGCCACCATAATC
AGTGCAGAGGAAGCGCGGGCCAAGGCGACCAAGCAGGTGGCAGACGTGGCCGCCGTCGCGGCCAAACCGCCGCCGGCTCCGGTGGACGCGGCCAAGGACA
AGTCGGCCGTGAAACACCGGGCC