Description :
From Genome Similarity Track
Location :
Scaffold_113:87088- 90529
Transcript NameFunction/comments
Aphas_H257_17488lipid exporter ABCA1 family

Sequence
3441 bases(100 bases per row)
GTTCGACATTGTCGTGTACACGCTCCTGGGGTTGTACTTGGAGCGCGTGGTGCCCAAAGACTATGGCGTGCCCGAGGTGTGGTACTTTCCCGTGAGTTCC
CAGTACTGGCGCAAAGTGCTTGGCCGCGGCGCCATGCGCGTGCAAGACAAGCATCACGTCGGCGACAACATCGCCGCCGACCTCGAAGGCCGCTCAGTCG
ACACGGTCGAGCGCGTCGGGCCCGAGCTGCGCCAGCAAGAAGTCACGGGGGACGCGCTGCAGATCACCAAGCTGCGCAAGGAGTTTGCCGTGCCCGGAGG
CATCAAAGTGTCGGTGAAAGGCATCAACTTGACCATGTACAAGAACCAAATCACGTGCTTATTGGGGCACAACGGCGCCGGCAAGACGACTCTGATCTCC
ATGCTGACGGGTATGATTCCAGCGACGAGCGGCGACGCCACGATCAACGGGCTGTCGCTCAAGAACGACCTCGCGGAAATCCGCCACTCGCTGGGCATGT
GTCCGCAGCACGATGTGCTGTACGCCGAGCTGAGCGTGTTGGAGCACTTGATGTTTTACGGCCGCATCAAGGGCTTCCGGGGCGCCGCGCTCACGGAGGA
AGTGGACGCCAAGATCGTCGAAGTGGGGCTGACGGAGAAGCGTCACGTCAGGACCAGCGACTTGTCGGGCGGGATGAAGCGCAAGTTGAGTCTAGCGATT
GCGTTGCTGGGCGACAGTCAGGTGGTATTTCTGGACGAGCCGACGTCTGGCATGGACCCGTACAGCCGTCGCAGCAGTTGGGAAATCATCCTCAACAACC
GATACAACCGCATCATCGTGTTGACGACGCACTTTATGGACGAAGCCGATATCTTGGGCGACCGCATTGCCATCATGGCGGAAGGGGAGCTGCGATGCTG
TGGGTCGTCCATGTTCCTCAAGAATAGGTACGGCGCCGGCTACAACTTTTCGCTCGTCAAGACGGATGACTGCGACACTGATGCGCTGATGGCGTTCGTG
CGATCCCACGTCGACACTGCCAAAGTGCTCAGCAACGTGGGCACAGAAGTGTCGTTTCAGCTCCCATTAGACTGCTCGCACTTGTTTGCGCCCATGTTTG
TCGAGCTGGACGCCAACTTGGCTCGGTTGGGTGTGCTCTCGTACGGCATTTCTGTGACAACGTTGGAGGAGGTGTTCATCAAGGTGGCCGAAGTGGGCGA
CGAGCACAATCAGCACACCCTCCAGTCAAAACCCACTGGGGCGAAACCGTCGACGGGGTACAAGATCGACGCGAACGCCCCGCCCGTGTCACACATTGCC
ATGTTTTTCATCCACTTCGCCGCGCTATTCAAGAAACGTGTGCGCACCGCCCGACGCGACCGTAAGATCGTCCTCTTTGGCGCGCTGCTTCCCATCGCGT
TTATCATTCTCGGTATTTCCATCCTCAAATTCAGCGCCCTGACCAAGAACGACGCGCCCATCCGGCTCGGACTGGGCAACTACACGCTGCAGCAGCAGAC
GCCAGTCCCGGTCTACTGCGTGGCCGACGACAACGGGTGGTGCACGGCGCTGGCGGCGGCCTTCTCGGCGGGTCAGGTGACCCTCCTCCCCCGCGACGAG
TACATGTCCCCCACGCCCACGGTGTTTCAAGTGACCTATAACAACCCACCCATCGCCCCGTCCGACACGACGGGGTTCTGCCTCAAATCTGGCGAGCAAG
TGTGGACGCGGGGGTTCCAGCAGGCGACGGCGGGGCAGTACGGCGCATACATCGTGCATGGATCGAGCACCACGGGCGAAGTCGGGTACGCCATTGCCGT
CAACACGTCGTCGCCCCATGCCGCCGCCAACTACAAGGCACTCATGGACCAAGCCGTGTACCAGATGGTGACGAAATCGCCATCTGCGACACTGGTCGTG
CACAGCCATCCGTTGCCGCTGACGGCCATGACCAAGACGTTGTTTACGACGTTCATTTCATTCGCCACGTCCATCTGTGTGGTGCTGGCGTTCTGCTTCT
TTTCGGCGTCGATTGTGCCCTACTTGGTGAGCGAAAAGCACCCGACGCACAACTCCAAGCACCAGCAGTTGGTCAGCGGCGTGAGTTTGCCGGCGTTCTG
GCTCGCTAACTTTGCGTGGGACATGCTCCTGTTTTCGGTGCCGTGTGTATTTGGGCTGCTCGCCATCTACGCCTTCGACATCACGCCGTTCACAGGTCAT
GCCTGCTCGACGTGCGCCGGCACGCCGTTCGCGGCACTCACAGTGCTGTTTGTCTTGCTCGGGTTTTCGCTCATCTCAATGTGCTACTGCTTGAGCTACA
TCTTCACCGACGCGTCGAGTTCGCAAACCACAATCATCATGATCAACATGATGCTAGGGGTCGTGCTCATGACGGTGTCGATTGTGCTGGACGTGGTCTC
GAGCACCACAGAGCTCAACAAGTCGCTCAAGTTTGTGTGGCGCCTCTCGCCGCTGTTCAACGTCGGCAACGGGTTGAATTCGCTGGCCATCTTTACGATC
CGCGCCACGTTCTCCCGCGACGGGTACGTGCCGGGGCTGACGGCGTTCGACACCAAAGTCGTGGGGTGGGAAGTCACATACTTGGCGGTCGAGTCGGTTG
TGTTTCCTCTGATTGCCATCGGCATCGACTACGCGTTGAGCTTCCCCAGCATCAAAGCCGCCATCATGAAAGACCCGCAGGTTGTGGATGCGCCGTACGA
CGTGGATGACGACGTCAAGGCGGAAGAGGCGCGGATCGCGAGTGGCGCTGCTGACAAGGACGCCGTCGTGATGAAAAATCTGCGCAAAGTGTACAAAGGG
GGCAAGGTCGGGATCGTCCAAATGTCGCTGGCGTTGCCGAAAGGCGAGTGCTTTGGCTACTTGGGCATCAACGGCGCCGGCAAGACGTCCACGATGAAGA
TCCTCACGGGGGATGTGCTGCCTTCAAAAGGACAAGCGCTCCTCGGGGGGTTTGATATCTTGACCCATCAGCTCGAAGTGCGTCGGCTGATCGGGTACTG
CCCACAGTTTGACGCACTGATCGACTTGCTGACCGTCCGTGAGCACTTGGAACTGTTTGCGTCCATCAAGGGCGTGCCATCCAAACGCATCTGCGACACG
GTCAAGGACAAAATGGACCAGATGAACTTGAACGACTTTGAGCACAAGTTGGCTGGGACGTTGAGCGGCGGCAACAAGCGCAAGCTGTCGGTGGCGATCG
CTCTGATTGGGTCGCCCCCGATCATCTTCTTGGACGAACCATCCACGGGCATGGACCCCGTGTCCCGTCGGTTCATGTGGGATGTCATTGCCGACATTTC
CACGCGCAGCAAAGAGTCGACGATTCTGCTGACCACGCACAGCATGGAGGAGTGCGAGGCGCTGTGCACCCGCGTCGGCATCATGGTGGGCGGCCGGCTG
CGATGTGTGGGCAGCATCCAGCACCTGAAGAACCGCTTTGG