Description :
From Genome Similarity Track
Location :
Scaffold_74:87075- 89710
Sequence
2635 bases(100 bases per row)
ACTGCGGACCACTTGCGGACAGACGACCAGACAGAGCGCGTTAATCGAGTGCTTGAGGACACTCTGCGCAGTGTGTGCGCGGCACCACCACGTACGTGGT
CGACGCAGCTTCCAGTTGTTGCGTTTGCGCTCAACAATGCGGTGCACGCGTCCACGGGGTTCACGCCGCTCTACTTGAACGGCTTCCGTCACCCCAGAGT
GCCTCTCACTCTTCGAGGAGATACTAATTCCTCTATTCTAAGTGGGGAGAGGCTCGGAAAGCCATTTTCTCCCAGGTCTCGGATGTGAGACCAGTTTCGC
TGCGAAAACAAGTGGATTCCTTTACGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATACCATGGCAGCCGCACCGGATAGCCAAAAGGAGTACTC
CGACAAATATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGAGACTTAGTGTTACTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGC
AGCACCAATCCGAAGCACCGCTTCATCTGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCTAAGCCAATGACGACGCACC
CGACGTTCTATGTGGGACGTCTTAAGCGGTAAATTGATCCGCAGAGGGTTGCTGACTCGCGTACCCACCTCCTCAAAGCGAGGGCGGGTGACAGACGTCG
ACGAGGGCGTCGGAGGCGGCGCCCAAGCCTCGGTCTAGACGGCAAAGCTGCGGTCAAGACTGTACACGGGAGGGGCTCCATACGAACGGACCCCGGAGCC
ATACGCCGAGTACGCTGAGTGCGCCGGGTACGCACCATACGCGTACATCTGGGAGTGCGTCGAAGGCGGCCCCGGACGTAGCAACAGAGCCTCGATCCGT
CGGATCATGCGGAAGGCCTCGTCCAGATCGGTCGAAGAGGCCCGGCGATCCACCTGCAGATGCCGGCTCGCGACCTCACGCTCCAACAGGTCCAGGCGGC
TCGCAATACGAGCGAGCTCGCCCTGGTTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCGATCTCAAGCTCGAGAACTCGTTGACA
GAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGGAGAAGGACTCGGGCGAGAATGGCGTTCGGGAGACGCCGAGTACTCGTACTCGTACGAGGCA
CCTCCGCCTCTGCTTGACCGGAATAGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAACTCCTCGTGAAGT
GGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGACCAGAAGCGGCGGTA
GGCTCATAAGTAGTCCGGGGTTTCTTGCCCGAACGGCGTACGGACGTTGAAGACACTCCGAACCCGCGCTTATCATGAGCGCTAGAAGCCGCGCGCTTCA
GCAGCAGCATGCACTTGCTGACCAAGTGGGCAAAGCGAACACGAAGATCGCGCTGGTCCAGGATGCGGGATAGCAGCTGCTCTGCATGGAGTTCCCGTAA
TTCCGTGGGTGAGTACTTGAGAGACCCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCAGGAGGGACAGTTCTCGGGCAGAACCCAGGGGTATCCT
TAAAGAGGATAGAGACCACCTCGGGTCTCGGGCTTCTTACGACAAGTCGTTAAGTCCTTAAGGGGGATGCGATGTGGCGCAAGAAGCACACACCGAGCAG
CCGCCGAGTTGTCAACAAACAACTGTTCCTTCTGAACAAGGGCACGCTCGTAAATGCCCCTAGAAGTGTGTCCACACACAAGACCACTAGGAGCGACGAC
AAACTCTAGGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCC
CCTACACACGCTGGACAGATTGGAAGTCCTCCTGCTGCTGGTCGAGGTCATACGTGACCTCCCGGGGCTCAGAGATCGCACCCTCCTCCTCCTCTTCCTC
CTTCTCCTCCTCTTCATCCGAGGAGTCGAAGAGGCCCCGATGGGAGTGCCGACTCTCCTTCTCCTCGCGGAGTGAAGACTTCGAAGCCTTACGCTTCTTA
GAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGTACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGGGGTTTCCCCTCCTCATCGCCACCAGCTT
TGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGACGTCCTGGGACTGTGATGATCTTGATCACTAGCAAGGGACTGCACGCTGTTGTC
CTTGTGTTCACTGGGCACTGGGCTGTGCCCTCCCGCAGAGCCCACAGGAGCATCGTGCGTGCTCTCGGACTAGGCTTCGTCCTCATTGCCAGCGTCGAAC
TCACGTTCCACGAACCGAGGGTTCGGATGATTGTCTGAGGCCGAGGGCGACGGGCTGTGGCGCTTGCTTGCTCGCTTGCCCACAGTAGCTTCACCCGAGG
AATCGATCGCCTCGGAGGCCACCTGAGTAGCCTCC