Description :
From Genome Similarity Track
Location :
scaffold_7:870499- 871514
Transcript NameFunction/comments
Plaha_PHALS_03627hypothetical protein L915_17861

Sequence
1015 bases(100 bases per row)
AGAATAATGTATAATGTATAGGAAAGACCGAAGCTGCGAGCTTAGAGCAAATAGTACATTTTAGTTGTCCTTGGGGTTTGCTTACAAGCGCATCCTTTGT
GCGCGGCTCATAATGGCTCATAGACTGAAAGCTCAGTGcgaggtgcacggcaacctcgTTAAATgatgttttttattttgatAACTATCAAATCCTAATC
TTGAGTCTTGTGCTTTGGGGGGGTAACCCCCCCCAAAACTCACGTTATAAACGAACTAAATTATTGCAGGTATACCCTTCCTTTTGAGAAATTTCAAACT
CTTGATAAGTTTTTTGAAAGACCTAGCCGACTCGCGCAAACATATGCTAGAGTACTTTTGGTATTGTTTCGTAACTTTCTTCAAGTTCAGTGGGCTGCTC
GGCTCATTCATATGTCTCGGGAAACTTGACAGGCACTTCACGGTTCTCATCGGGTGACCAAAGCTTCCCTCCGGCCAACAACACCGTGATCTCGTCGCAC
GACAGACTGACCGATGATATGGAATCGAAAAGCTGTCTAGACGATGTGTTTTTCGGAAATGTATGCAGCAGTCGCATGACGTTTTCTGGTTCCATGGCCA
GCAAagaattttgaaaaaatgatAATAGACCTTTACACAAGCACGTCAAGTCAGAGAATCGGCTTGTACTCTTCTTATTGTACAACAAGCGTATGCAGTC
CGTACCCATGCTGGCCTGGAAGAAGAACGGCGTACCGAGAAGAACATAAACGTCCCAAATACGAAGCGCAAGATCCAATGGCAAGCTCCGCGTGAAGAGT
GTGAGAGCCCTATACAAATCCTGTTAGCGCCCAAGCACATCAAGTAGTATTTGGCTAGCATACCAGTCGACAGCATACATCTGTGCATCGATACCGATTT
CTTCAAAATGCGCGGCCAAGACTGGCAGCTCGTACTCAAATATCTTGTTGTACACGTCAATATAATGGAATGTCTTCGAGAAAAAACAATATCGTTGTCA
TAAGCTGATTTGGTT