Description :
From Genome Similarity Track
Location :
Scaffold_276:8704- 13726
Transcript NameFunction/comments
Hyaar_Emoy2813438hypothetical protein

Sequence
5022 bases(100 bases per row)
TCTCCCGATGAAGAGACCTCGTGCCGATGGTACGGGCGGAGACGACCTACATAAAACGTAGGATGCGTACGCATCCTGCGAGGTAACTCTATCGTGTACG
CATTGCGTTTGCGATGTAGTACACGGAAAGGGCCGATGTACTTGGGTAATAGTTTACTACTACCCACATTAGTTACTACGTGCTTAGGTAGATCAACCGT
AGACAGTAGAACTAAGTCTCCGACATAAAATAGAAGAACGTTTGCTCTTCCATGTTTGTCAGCGTTCCATTTCTTCCGGTCCACCGCGTTAGCGATAGAG
TCTTGCACGAAACGGACCACTGCTTCTCGTGCCAGCAGGAAATCTTCTGCTGAATCACTTTGGTTTGTTGCAGTACGCACAAGGCGCACTACTAGGAGAT
CATCCTCTTTTTCAGCGAGGGTGTTTTCATCCTTGCTGGTGTAGTCATTGGCGATGCGTAACATACCAGCATCATCATCCCCATCTGGGTCAGCAATAGT
GTCGCCACGATTGCAGAGATCATCAGCTTCGATTTCGATTTGATCGACATCGGCAACGTTCGCGTCGTCGATTACCTCGACACGTGATGGCAAGAGCCAG
AACGGTTATTTCTCGAGCAACCTCCCCCCTTGAATTAGTGTCACACTCTAAATGGGTAAGTAGGCGTGGATGGCGTAAGCCGTTCACAAAAATGGTGTAT
GCGTTGTCGATGTATGCACGGAGTTGTTGATTACAAACTCCACCATAGGTAAAAATTCGCTCCAACCTGTGAAAGATTGGACGTACCCTCGAAGTATCTC
TTCGAGGACGCGGTTGACGCGTTCTGTCTGACCATCAGTCTTGGGATGGTCAGAAGTAGACGTATTCAGACGCGTTCCGAGGGATCGGAACACGGATTGC
CAAAGCGCCCCCGTGAACCGAGGACCTCTATCAGAGACTTGTTCACGGGGTAGACCGTGGAGTCGGAATACCGTGTCAATGAAGACACGGGCGCAAGCAT
GTTCTGAGATTGACTCATTAACTGCAGCAAGATGTACCGTCTTGCTGAATCAGTCTACGAACACAAGAATACCATTATTCTTGTGAGCGTCTTCGGGAAA
ACGGAAGACGAAGTCCATTAAAATGGACTGCCAGAACTCTGCCGGGATTGGTAGAGGATGTAGTGTCGTACGGGATGAAGGACTGGGCTTCACCCGTTGG
CACACTTCACAAGCACGAATGTACTTGCGCACAAACTGATACTGGCGGGTCCAGTAAAAGTCGCGACATACCGTGAGATAAGTCTTCTCACGCCCACGAT
ACCCACTAGTTGGTGCATCGTGACACTCATACATGATGGGTAAGAGCAAATCATTATGAGTGGGGACGACGACACGAGGTGTGTCGCTGGTAACGGCTGT
ATAATACAAAGCAACATATTGCGCGTTGTGTATCGATCCACGAAAGATTGATACAAGACCGGTAAATCTCTGAGAGATTTACGAGATGGAGTCACCAGAT
GATCCATTAGTCGCAGAAGATTCTTATCTTCTGCATAGGCCTTTTTATATCATCAAGCAGTATTGACGACGGGACACTAGTGACCAGTGTTGCAACAGTG
GTATTAACCCCACTGGTGGACTGCGCAGCCAACTAGAAATCGGGTCGGCGAGACAACCCGTCCGTGACGACATTAAGTCGTCCGGGTTTGTACTCCACGG
AGAAGTTGTACTACACAAAGAAGGACAGCCACATCGCCATCCTTTGCGAGAGGTGTGGGCTGTTTACGGCCGTGCGTAATGACGCATGGTACGTATAGAC
TACAAACGGCCTATCTCCAAGGAGATTGACGCGAAACTTCTATAGTGCATACTTGATGGAAATGGGTTCCTTGTCATGAACTGGATAATTATGCTTAGCC
GATTGCAGCTGACGCGATTGTTAACCGACGACGCGCTCTGCGCCGTCTGCATCGTACTGCATAACGCACAGCCGATTGCAAAATCGCTGGCGTCACAGAC
CACATGGAATGGTCTGTCTTGGTCAGCAATCGCCAAGATGGGCGATTGCATCAAGCTCTTCTTGATTTCTTCAAAGGAACGCTGACAATAAGCGTGCCGT
TACCATTTCTCGTTCTTTTCAAGAGACGAGAGAGATGAACGGTCATCTCAGTGTAGTTGCGCGTGTACTTGTGTAAGTACGCCGCCAGACCAAGGAACGT
TTTAGTCCCTAAACGTCGACTGGCACTGGCTAGTCGGTAATCGCCTTAATATTTTCTGGATCAGGGCGTACGCCGTGTTTACCCACGATGCACCCAAGAA
GTGGTATTTCGCTAGCAGCGAATATAAACTTCCTGAGGTTGGCATACAGCTTATGCTTGCGCATAAGTGTAAGAACCTGACGAATATGTGTTCTATGAAC
CTCTACGTCCGTCTCTCCGCCCATAGCCCGGCTATGGACGAATACATCGTCGAAGTCTCGCACCGGTCTCAACAGATCTGCAACACATCTGTTGAATGTG
GCAGGGGCGTTACTCAGCCCTTGTGTCATTACTAGCCACTCCCAGAGCATACCCTTCAGGGTGCTTACTGCCGTGTAGGGATGTCCCGTTCACGCATTAG
GATCTGATAGAAGCCATCTATTAGATCCATGGACGAAAAGATGGTACTCTTTGACATACCATCAATGATTACGTCCTTCCTCGGTATCGGCGTCTGAGCC
AGTACCGTTGCAGCATTCACCTTGTTGAATGAGTGCAATATCCACCACCTCCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGGGGGGGAAGC
TGAATCCCTCACATGACCCGCTGCTAAGCGATCGGAAAAGAACTTGTCGATGGCAAGTACTTGTTCACGAGGCAGTGGCCACTGCTTCATGACACAGTAT
TTCGAGCCCGGTTTGAGCTCGATTTCATGTCGATTGCCATTATCCTTAGGCAATTCGCATGGTACGGATTCAGGGAACACGTCCTTGAATTCGGTCAAAT
CTTTAAAAAAGGATTTGCCTGAAGCGACTCCCGAGATTGAGACGTGTATTGCTCAATCCGAGTCTACTCATCGAGGACACTTTCGTCCATTAATGAGATG
CTGAGAACCCGTTCGTTCTCGGCAAATACTACTGCCGACCAAATGTCAGTCACGTACTCCTCCTCCATGAAGAGTACAAAGATCTGCTTGACTTTGCCAC
TGCGCAGATCTCGCAAGAACCGTTTCGGTTCTAGCGTTGGCAATTGAGTAATCTCCGAAGTCAACTTCGGAGGCGCGATCTGATTAAGTGTATAAGCGCC
TACACTTGACCCGTCATCAACCAAGGCATTCAATGTTTCAGCTTCTTCATGGGAACCCTGTTCCACAGGCTGCTGGGGACTTATTCCCTCGACGTCTTCT
AGATGTGGTTGCGCTACCACAGCTAGATCCTCTACAATCGAATCTCTATCCGATCTAGGATCATCGTGTTACCCTGTGTGGGCAATGGGTTTATTCTTTC
TTGGATGTCGCCTGCTAGGCGTACACCCCTGTCCCGATCCACTCGAATCGTTAGAGTTGTGGATCTTTGGTGCTGCTTGTGCATCCGCACAGCTGCCGGC
AGCTTCCTCCACAGTGTGATTGGTTGTCACACTGTGATCTTGTGCAGTCCTACTAACGACCGTACCGCAAGTGAGGCCATCACACTCAGTACATGCACAC
GCTTTTGGACGCTTCAAGACGTTCATCAGATGTCCATCTGATGAACAAGCGGCAGGAATCTTCACGGTTCGATGCTGCCAGCTGACCCTTGGCTCGTACC
TTCTAAGCCAGGGTAACACTAGAATGACATCAAATTTGTCATACAAATCAAGTTAGATGAAATCGTCATTGACTGCAAATCTGCTAACGTGTAGTGAAAT
CTCACTACACGTTTCATCAATGCTATCGATGCGCCTGTTGCGAGGCGTACCGTCAGCCTCGTAGAAGAAATAACGCGCTCAACAAAATTGAGCCTACGAT
CCTCTAGCGACTGGCGACGAACACAGTGTTCGACGCCCCACAGTCAACTAAGGCACGAAGTGACAAACCTTTTGCCACTTCTAAATTCAAGGTGATGAGG
GGTACATCATCACCAAGTGCAGAGACACACAAGAATTGTGAGTCTGGATCAACTTTCATCAATAGATTTGCAAATTCTATTGAGGTTGCTGGATCAGTAG
GGCGCTCCGCCCCTACTGACCCCGACCGTTTTTTACGGTTCGCCACGCTGTTGTGGCTTTGCAACAGCGTCGGACCCGCGTCCGTTTCCCTTCTTGGCAG
ACGGTTGATCAGTTCGCTCAGTGTTACGAGACACTGGGCGTGAAGTACTACACTCGTAGACGTAGTGTCCTAACTTCTGACAGCGATTACACTTTTGCAA
TCGCTTACTGCTTGAAGAGAGAGGTCTCACGCTCTCAACACTGCAGAGGTCCGTTGGTTCTGGAACTCCCGCCTCTACTCGTCTCGAAGGACTATAGGGG
GTCAAGCTAGTGTGAGCCTGTCTCACACTAAAGTCCTCTTGCACCGCAGTTGTGATCGATTCCTCAAGCGACTTCAACTCAATGTGGAATAGGTGGTTCC
TCACGGGACCATCTTTAAGGCCCTGTAAGAATACCGTGATCAACACGAATTCACTTACAGGGTTCGCTGTCATGCAACTTTCAAGGTAAAGAACATGCTG
AGCGTAAGCGTGAACGTCACGCTTACCTTGTTTTATCTTCAGGAGCTCTGAAAGAGTTCTGGACTTAACTCTTGGCGGCTCAAACGTTTGGCTGAGCAGA
ATCTGAAAGACCGCCAACGATCCAAACACGTTTGGATTGTGTAGTTGAAGATCTGGCCCAACTTCTGGCACGCCCTGACAAATATGATTTGGCAAATGCA
ACTTGCAATTCCTCATCGTCGATATGGCGAGCCTTAATGTCATCGTCCACTTCGAGGAACCATCTCAACAGGGAGTCTTTCTCGACTCCCCGGTACTTGG
ATACTTCTAACTTTAGAGTCTC