Description :
From Genome Similarity Track
Location :
Scaffold_276:8703- 11977
Transcript NameFunction/comments
Hyaar_Emoy2813438hypothetical protein

Sequence
3274 bases(100 bases per row)
TTCTCCCGATGAAGAGACCTCGTGCCGATGGTACGGGCGGAGACGACCTACATAAAACGTAGGATGCGTACGCATCCTGCGAGGTAACTCTATCGTGTAC
GCATTGCGTTTGCGATGTAGTACACGGAAAGGGCCGATGTACTTGGGTAATAGTTTACTACTACCCACATTAGTTACTACGTGCTTAGGTAGATCAACCG
TAGACAGTAGAACTAAGTCTCCGACATAAAATAGAAGAACGTTTGCTCTTCCATGTTTGTCAGCGTTCCATTTCTTCCGGTCCACCGCGTTAGCGATAGA
GTCTTGCACGAAACGGACCACTGCTTCTCGTGCCAGCAGGAAATCTTCTGCTGAATCACTTTGGTTTGTTGCAGTACGCACAAGGCGCACTACTAGGAGA
TCATCCTCTTTTTCAGCGAGGGTGTTTTCATCCTTGCTGGTGTAGTCATTGGCGATGCGTAACATACCAGCATCATCATCCCCATCTGGGTCAGCAATAG
TGTCGCCACGATTGCAGAGATCATCAGCTTCGATTTCGATTTGATCGACATCGGCAACGTTCGCGTCGTCGATTACCTCGACACGTGATGGCAAGAGCCA
GAACGGTTATTTCTCGAGCAACCTCCCCCCTTGAATTAGTGTCACACTCTAAATGGGTAAGTAGGCGTGGATGGCGTAAGCCGTTCACAAAAATGGTGTA
TGCGTTGTCGATGTATGCACGGAGTTGTTGATTACAAACTCCACCATAGGTAAAAATTCGCTCCAACCTGTGAAAGATTGGACGTACCCTCGAAGTATCT
CTTCGAGGACGCGGTTGACGCGTTCTGTCTGACCATCAGTCTTGGGATGGTCAGAAGTAGACGTATTCAGACGCGTTCCGAGGGATCGGAACACGGATTG
CCAAAGCGCCCCCGTGAACCGAGGACCTCTATCAGAGACTTGTTCACGGGGTAGACCGTGGAGTCGGAATACCGTGTCAATGAAGACACGGGCGCAAGCA
TGTTCTGAGATTGACTCATTAACTGCAGCAAGATGTACCGTCTTGCTGAATCAGTCTACGAACACAAGAATACCATTATTCTTGTGAGCGTCTTCGGGAA
AACGGAAGACGAAGTCCATTAAAATGGACTGCCAGAACTCTGCCGGGATTGGTAGAGGATGTAGTGTCGTACGGGATGAAGGACTGGGCTTCACCCGTTG
GCACACTTCACAAGCACGAATGTACTTGCGCACAAACTGATACTGGCGGGTCCAGTAAAAGTCGCGACATACCGTGAGATAAGTCTTCTCACGCCCACGA
TACCCACTAGTTGGTGCATCGTGACACTCATACATGATGGGTAAGAGCAAATCATTATGAGTGGGGACGACGACACGAGGTGTGTCGCTGGTAACGGCTG
TATAATACAAAGCAACATATTGCGCGTTGTGTATCGATCCACGAAAGATTGATACAAGACCGGTAAATCTCTGAGAGATTTACGAGATGGAGTCACCAGA
TGATCCATTAGTCGCAGAAGATTCTTATCTTCTGCATAGGCCTTTTTATATCATCAAGCAGTATTGACGACGGGACACTAGTGACCAGTGTTGCAACAGT
GGTATTAACCCCACTGGTGGACTGCGCAGCCAACTAGAAATCGGGTCGGCGAGACAACCCGTCCGTGACGACATTAAGTCGTCCGGGTTTGTACTCCACG
GAGAAGTTGTACTACACAAAGAAGGACAGCCACATCGCCATCCTTTGCGAGAGGTGTGGGCTGTTTACGGCCGTGCGTAATGACGCATGGTACGTATAGA
CTACAAACGGCCTATCTCCAAGGAGATTGACGCGAAACTTCTATAGTGCATACTTGATGGAAATGGGTTCCTTGTCATGAACTGGATAATTATGCTTAGC
CGATTGCAGCTGACGCGATTGTTAACCGACGACGCGCTCTGCGCCGTCTGCATCGTACTGCATAACGCACAGCCGATTGCAAAATCGCTGGCGTCACAGA
CCACATGGAATGGTCTGTCTTGGTCAGCAATCGCCAAGATGGGCGATTGCATCAAGCTCTTCTTGATTTCTTCAAAGGAACGCTGACAATAAGCGTGCCG
TTACCATTTCTCGTTCTTTTCAAGAGACGAGAGAGATGAACGGTCATCTCAGTGTAGTTGCGCGTGTACTTGTGTAAGTACGCCGCCAGACCAAGGAACG
TTTTAGTCCCTAAACGTCGACTGGCACTGGCTAGTCGGTAATCGCCTTAATATTTTCTGGATCAGGGCGTACGCCGTGTTTACCCACGATGCACCCAAGA
AGTGGTATTTCGCTAGCAGCGAATATAAACTTCCTGAGGTTGGCATACAGCTTATGCTTGCGCATAAGTGTAAGAACCTGACGAATATGTGTTCTATGAA
CCTCTACGTCCGTCTCTCCGCCCATAGCCCGGCTATGGACGAATACATCGTCGAAGTCTCGCACCGGTCTCAACAGATCTGCAACACATCTGTTGAATGT
GGCAGGGGCGTTACTCAGCCCTTGTGTCATTACTAGCCACTCCCAGAGCATACCCTTCAGGGTGCTTACTGCCGTGTAGGGATGTCCCGTTCACGCATTA
GGATCTGATAGAAGCCATCTATTAGATCCATGGACGAAAAGATGGTACTCTTTGACATACCATCAATGATTACGTCCTTCCTCGGTATCGGCGTCTGAGC
CAGTACCGTTGCAGCATTCACCTTGTTGAATGAGTGCAATATCCACCACCTCCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGGGGGGGAAG
CTGAATCCCTCACATGACCCGCTGCTAAGCGATCGGAAAAGAACTTGTCGATGGCAAGTACTTGTTCACGAGGCAGTGGCCACTGCTTCATGACACAGTA
TTTCGAGCCCGGTTTGAGCTCGATTTCATGTCGATTGCCATTATCCTTAGGCAATTCGCATGGTACGGATTCAGGGAACACGTCCTTGAATTCGGTCAAA
TCTTTAAAAAAGGATTTGCCTGAAGCGACTCCCGAGATTGAGACGTGTATTGCTCAATCCGAGTCTACTCATCGAGGACACTTTCGTCCATTAATGAGAT
GCTGAGAACCCGTTCGTTCTCGGCAAATACTACTGCCGACCAAATGTCAGTCACGTACTCCTCCTCCATGAAGAGTACAAAGATCTGCTTGACTTTGCCA
CTGCGCAGATCTCGCAAGAACCGTTTCGGTTCTAGCGTTGGCAATTGAGTAATCTCCGAAGTCAACTTCGGAGG