Description :
From Genome Similarity Track
Location :
Scaffold_89:87027- 89141
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_128423'5'-cyclic nucleotide phosphodiesterase, putative
Sappa_CBS223.65SPRG_21204Hypothetical protein
Sappa_CBS223.65SPRG_21205Hypothetical protein

Sequence
2114 bases(100 bases per row)
CGCTTGCAGCAAGGCTTCCAGCTAGCACAAAAAAGCGAGTAAATTTTCAACCCAATCCGTACATCCCGACCTCGGACGTTTTCATCTTGAGCTTGTGGAT
CTCTTCGTCCTTCTTGGTGGTGGTTGGTGGCCGCGAATCCAACTCTTTGGCAGCTAGGATTTTTTCGTTGCGCTGCTTGTCCTTGATGACTTGCAGCGTA
AGGTGCTTGAACCGGTTGGCGTTGACCCCGGTCGCGTTCGGGCTCTTGGACTGCTGCTGCATGGTCTCGACCTTGAGCTGCTGGTCCGCGAGCTGCCGCT
CCAGTGTAAAAACACGGTGGTTCATTTCATCGAGCTTTTGATGCAAGACGCGCTTCTCGCTCAGTAGCGTCTTGGTGCCATCGACCACGTTCTGCAGAAT
GTGCTTGGGCACGACAACCGTCCCGGACGAAGCCTCTGCGTCGCCCATAAGTGCTGGAATACGCTGTGGCCAAAGCGTCGAAGAAAGGATCGAAATGTTC
TCTTGTTCGGAAAACCACGCGCCAGCGTCTCCATAAAATACGTGGCAGCATCTGCATGCGACTCTCGATCTATCTTCATGGAATACTGATTGATGCATCA
AAAGTCGTTGCATTCATGTTTGTAGCGTATACATCTTCTCGGCTCGCAATCACATCTACATGGCCAACTACAAGGCGACCGAGCTCGCAGCCGGGGCCGA
CACGGGCGCGGGTGTCGACAGGTGCTGACTGCTGCTGCTGTAGGATGCCGCCCGCGTCGAGAGAGAGCCGCGGTTGAGGCCGTTCGCAGGACTATGGAGC
AATAGGTTCTTATTGAAAGTCCTTCCAACCTCGCGCCGTACCTCTCCACGGCCATCGTGAGTGCATCATAGAGCGGTTGCGCAGCAACGGGTGGGCGTTC
TAGACTCTGTGCGTATGCGCTCAGGGAAAATCGAAGCAGGCCGTACCTCGGCCGCTGAGAAGGTCTGCCGCTGTGACCTCCTTGCCGTAAAACTCCAGGT
TCACATCCGGTCGCGCGAGCACGACCGAACCTTCAACCGAAATACCGATAAAAAGTCCCTGCGGACTTTTGTTATCGACAATATATGCCAGAGAAAGTCA
TCGAGTACCTTGGAGTGCGAGTACGAGTAGCACGGTGCGATGCCACCAGGACCTACCCGCGTCATATGAGTGGTAACCACAAGGCGAGGCGACTACCGGC
TTCCATCGCGCCCGCAGCAACACGTCCGAGCGGCCCGGCGGCCACCCCGAGCTCGGCACCCATGTTGACTTGGCCTTGGGCACAGAACGTATCGACGGCA
GCTACCACGCATAGTATCAAGTCGATACATTGATGCATCTTGCGAGGATGATCGTACAGCGGGTGTTGAGGATGATGACAAAGTCGGTGACACCGCCACC
GATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGGCTGCACGGCGTTGCTAGCAGTCGCGCCTAAAGCTTCATGACGCAAGGCGATGAGAAAGGTCATTACAGAGCAGGCTTTGATCGGGCAAGAGCA
GCGTGTAGCACGGCTCGCACACGCGCTGCGGGTTGTACGCGTTCACCGAGAGGTACCGCTTCTCGGGGGACGTTAAAATCTTGTCGTCGCGGATCAAGCT
GCGGAACGTCGTGCAGAGATCGCAAAAGACGTGGCCTACCACCGCCGAATGTCATTTTGCATGCACACAAGCAGCATCGCAGGCTACCGCAGTATCTAGC
CAAGGCCATGATGAGCCAAGCATGGGCGAGACAGGCGTACCGGCAATGGTGCTTGCGCCGGACCCAGTCAAAGAGGAGGCCACAGGCCTTGCAGAGAGAC
ACCTCGGCGTCCGGGATCCAGCGGATCGTCGTCGGGACGCTAGGCTTGTCAAAGAAGGCGGCGTCCTCGGCGCGGTCGTCTCCTGCCATGCTGCACTTCG
AGCTTGGATGGGTTTGGCCGTTGTTCTGGTTTCGAAAAATCCGTCGAATAGCCTCTTTGATTTGATATTTGAATATAATATCCCAAAGGACCTTTCAAAT
AGCATATATCGGCG