Description :
From Genome Similarity Track
Location :
Scaffold_19:8700- 9857
Sequence
1157 bases(100 bases per row)
CAGATGAAGCCCGCAGAACGAAACTACCCTGTTCACGACAAGGAACTACTCGCTATGCGTTATGCTCTGATCAAGTTCAGAGTGTATTTGTTGGGCGAGC
AGACGTTCGCGGTCTACACTAACCACGCATCGCTGCGAACAGCGATGAAGAGCCCACACTTGTCCCAGCGCATGGCTCGCTGGTTGTCGTTCTTCTCCGA
GTACAACTTCGTGGTTCACTACAAGCCCGGCAAGAACAATATTCTTGTTGACGCCTTGTCGCGTCGCCCCGACTACGATCCTCGGAGCGTACTAGAGTGT
GAAGACCCTGACTTTGATGAAGACGAATGCGCCGCGTGTGTATCGCTAGGCCTGAACCTGACGAGCGTCGTTCCGGTGATGTCCCTCCGAGACGAGATCA
TCGCAGCATACGAATATGACGCAGTGTATTTCAACATCATCGCTCATCTCCTTTCCCCCAGCGATAATACACTGGGTGCACTGTCGCGGTCTTCTCGCAA
CCAGATTCATCGTTATCGGCTCGAGGAATGCTTGCTGACATACTGTATCGATACCTTCGACGCTCCGCGTGTGGTGGTGCCAAATGATCCGGATCTTCGC
TCTCGAATCATTTACGAGTTCCACGGTGCTCCCATCGGTGGCCACCTCGGCCGCGAAAAGACGTTCGTGGCCATGTCGCGAGATTTCTACTGGCCGCATC
ACTACAAGTGGGTTCGCAAATGGGTCCGCTCTTGTGAAGTGTGTCAACGAGTGAAACCATCCTCGTCGTCGCAGGCTCCTTTACGCCCTCTTCCAATTGC
TACAGAGCCCTGGCGATCCGTTTCTATGGACTTTGAATTCGGTCTTCCGCCCGACACTGAAGGTCGGACGCTCTCGTGTTCGTTGATCGTTTCAGCAAGA
TGGTCCACTTCGTGCCGGTTCGCCCAGAGGTCACCGCGGAGGAATCCGCGGTGTATTTCATCTACGCTGTCTTCCGCCATCATGGTCTTCCTGAGTCGAT
CGTCTCCGACCGCGATCCGCGGTTTACTGCCGCCTTCTGGACGAAGCCGTTCGAGTTATTGGGCACCAAGTTGATGATGTCCACCGCTGGGCACCCGGAG
ACTGACGGCCAGACCGAGCGAGTGAATCGTGTCTTCGAAGACGTTCTTCGAAGCTAC