Description :
From Genome Similarity Track
Location :
Scaffold_525:870- 3343
Transcript NameFunction/comments
Phyag_g6379conserved hypothetical protein
Phyag_g6380hypothetical protein

Sequence
2473 bases(100 bases per row)
ATGTTGCAGCGAGTTTTGGCTCGAGAGAATGTGGACGAACGTCAGCGTGGGTTAATTCGCGCTAGCGGCATCACCACGCACCGACAATTGATGCATCGCC
CTCTGTGGGATGTCGCCCATACTGTAGACATGTCGGTTCGCGAAACGGAGGTTTATTAGCCAAGAAACTCCACTTTTAGTAAATGTATCACAACAACACT
CACGGATTGTCATTTGTATAGGAATTAGTGGCAAAACTCTCGATCCGACTGGCACCAGCAAGTCGTTCGGTAGTGACGCATCCTGGATTTCTATGGCAAT
GAAGATACTGCGAGAGGTTGTTGCTCATTTGCTCTCTGGGTGTGTATTGGCAGGCcttcgatctcttcctgGAAAGCGCCAATCACCCGACATTCCTACG
CACAGGACTGGCAAGCATTGATCAAGCATTAAATGGTGGACTGCACTGCCGAGCACTATCAGAGGTGTGTAAATTAGAGTGGGGTGATGATATTTGTTTG
CTGATGAGACTTTTTGGAAAAGTTTGTTGGAACTGCAGGAATTGGCAAGAGTCAAGTTGCGATGACACTGGCGGTGGTGTGTGCTATGGACTACCCGGAC
AATGGAGTGGTGTTCTTCGATGTAGAGCACAACTTTAGTGCTAAGCGGTACGTTTGTGAGATGCAGGGTGATCAGGATTGGTATaatgattttttttttc
gatGCAGTCTATTGCAGGTTACCATTGCGCGAATTCGACTGACCCAcgcaggccaagaagcagataTTGACGAGTTGGCTGTGGCAGTCATTAGGCGTAT
TCGTGTCGTAAAAGTGGCCACTATCGCAGCATTTAATGCCAGGTGCGAGATCGTTGCTGTGAGTAGAACGTGTGTTGCACCGTCGTAGTGCTAACATTTT
CATTTGTGGTGAACGTGAGCAGGTTCAAAGAGATGGAAGATGCCATGCACGCGCTCAAGATCAAGCTTATCATTGTTGACTGCATTACAACGCTATTCCT
CAAGGTTAACTTTCTCTAGATTTTTGTTACTTCCGTTCACAAGTTCTAATCTTGTGGGTTTCATTATTGCGACGTCAGGCTGACGACTTAACGCATGCTC
AGCGCCAGCATCAAATGCTGCGGATGGCAAGAGATTTAAAGTGAGTTGAGGGGTACTTCCGTGCCTTCTGATAATTCTTGGTGAGCTAACAATGTGTGGC
GCCATCAGATTACTCGCCGATACATATCAAGCATTCGTTGTTGTCACTAATCGTGCCACCACAGTTGACGGCGAAGGTAAGAAGACTTCAGTTTTACTTC
TTTGGtcctcttgctgttgttatGCGGGCTCTTGTTATTCTAACTCGATGCTTTTTGAAGGTGGTCTGTATACAAAACCGCAGCTTGGCGATAGCTGGGC
ACACTGCGTCACCACAAGGGTCAGTGAAAACTGAGCCTGCCATGTTTACTTCAACATCTCTGACAATTGCTTGTGTGCTTGTATGTTGCAGTTCATTATG
GAGCGGCATTCTCTGTATCGAGCCATCACAATAGTGAAGTCATCCGTGGCAGGCTACGTCGTTCAGCCCTTCACCGTCAAGGTGCACATTGATCTACACA
AGCAAAACGGCATCTCAATCAATCTCTCACTGGCAAATGTGCTCATATCGCAGGAAGGTGGGGTAGAACCACTagaagacgaggagactTCACGACGAGC
AGATTCGGACGAGTTCGCCATCCACGACGACTTGCTGAGCGACCTCGCAATGGCCGAACTACCCTCGGTAGACCCTGCATGCACGCTCCGTTCAACACAA
CAAAGCAACGCCGAAGACCCCGATGCAACTCAACTCATGGAGCAAAGCGACGGCGATTCTCAGCCAAACCAacaaaatgaagaagctgcagaaagcagca
gcttcgacatcgTGTCCGACTCCAACTcagaagaggacgatgaatCCTCCTTCTACTGGGGCGCCGTCACTGAGGAGTAAGACAACAAAAGTCATCTGAA
AAAATGCAAAAAAAAGTTGATCAGCGCCGTGTCGAGCCAAATCGACATGGCGGGAAGCTTAGGAGGGTGTATTTAGTCCGACGCACGTTCAGCAACTAGG
CTGTCGACTTACGCCTTAAGAGCGTAGCGGCGCTTGGGGTAGTACgactccttcttctgctgcttgagcgtcttgagcgacTTCTCGTGCGTGGAGAGCT
GGCGACGGATGGCGCGCGTCTGCTTGCGGCGCAGGTCCAGGGGCacgtgcttcttgctgccgagaGCGGCACGGAGCTTGGCCTTCTGGTTCTGGTTGTA
CACCGTCAGCACGCGGGCAATCGACTTGCGCACCACGCGGATCTTGCTGAGCTTGGAGGCGGCGCCGCCGACGACCTTGGCCACGCGCAGCTgggccagc
tcctgctggtaGTCGTCCAGCTGACGGAGCAGCTCAGTCTTGCTCTTGGTGCGGAGCTCGTGCGCCTTGATCT