Description :
From Genome Similarity Track
Location :
Scaffold_1959:870- 2052
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1959-snap-gene-0.1HECT ubiquitin ligase

Sequence
1182 bases(100 bases per row)
GAGAACCGTCCGCTGGACAGCGGATCGGCATTCAGCATGAACAGTATGCTCTTTGGGGTGCTCGCGGGCTTCATGCTCTGCTGGGCGCTGCTCGTCGTCT
GCATCCGCAGGTCCTACGCGCAGCGCATGCGCGACGAGCGGCTCAACGCGCCGCTGCTGGGCGAGTACGTGCGTGTGTGTGTGTGTGTCGTTATGACGCA
GCAACTTGTGCAACATGTTTTGAACGTGTGTGCAATAACTAACACTTGCGCTTGCGTTGTGTTGTGTTGTTTGTTTGCAGCTCGAATGAACACCGCTTGG
ACGCTGCGATCCGGTATGTTGGAGTGAACTTTCTGCTGCTGTATTGCCTGGTGCTGGTGACTAATGGTTGCTATGATGGATGTGCTGTTGTTGTTGCTTT
GACAATATAGAGGAGCGGAGGAAGGCCACAAGGAGTGTGGTGTGTGCGGCTTTGAGAACTTCAAGCGCTTCTTCTTCTGCAACATCTGCGGCGAGAAACT
GCGCAGCAAGAGCTCAACCAACCACAACAACAACACCAGCACCAACAACGCAAAACCAACAACGACAACATCGACAGCGCTGGAGCGCAGCCGCAGCAAA
GGCGCGAGCGAGTATCGGAGCGAGTCCTCGCTTCAGCTGGTTGAGTGCTCTGCGAGTAGCGAAATGGCGGTCGTGGTGCCACGTGCACTGTTCACACAGC
GGCAACGACGAGCCAGGTATGATATAGTAGCTAGTTACTGGTATTGGTATCCTAGCGTTTCTGTATCTAACGTTGCTATTGGTTGCACTTGTGTATAATG
CGATGGTGGGATTGTTTAGAAAGCGCAAGGAGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGGACGAAGAGCTCTTCTGGTATCGCGATAGCAGCT
GCGGAGCGGATCTGCGGTTCTCAGGGTACACGCTGCAGTACCAGGGCGACCAGGAGGTCAAAGAACCCGAAAGTAGTGCTCAGGATCGTCATGAAGAAGA
GTCGCAGGTTGAGCTGGAGCCAATCACGATTGTGGTGGAATCTGTCAATCCTGAAGGTGCAATCAACGGTATTCCGGAACCCAACACAAGCCAAATTGAG
CCTTCGCCAGCATTCGCAGAGCCGGAATCGAATGGCCAAAACAATGGAAACCAAAGTGAGAGGCCAACAACGATCGTAAACG