Description :
From Genome Similarity Track
Location :
Scaffold_84:86990- 91177
Sequence
4187 bases(100 bases per row)
ACTGGGGTGATAATGGGATGACAATATCCACATTAGCAAGATGTCGCTTTTCCCTACATCTGACGGAGTACTGCGATCCTCTCTACGCGGGTGAGATCCG
CCCCCTGTTCTACTTGGATATCCATCAATAGGAGACCAGCTATGTGGGTCAGTGTTATCTCCGGTGATGAGCGTGAATAAATGGTGCGAGATCTTCCATC
GTGTAGATCCCCGCCTTCATGGTAGCAGACGAGTTCATCTTCCGTCTTAGTCGGAACCACTACTGGATCCAAGCACCGCGACTCCCCCTCTTCCGTCATT
CGTTCTGTTTTCATAGGATCGGGTACTCTGGTACCGGAAAAAATACCTTTTGGATCGACTTGACCTTCTGGTGAGTTTACACACGACGGCTCCTGTTTAG
CCTGGGTTGACACTCTCAACAGGGGTCCAGGCATCCTATCCCATGGAAAGTTCGGATCCAACCGTGGGTCAGCAGGATCCGGCGCGCCGCATTCAATTCC
CCCATCAAACCGACCCTTGGATATCTAGGGACCGGCTCTGGGTGTCTCCAGCCGTCTTGGATCCAACTCCTCATCCACTTGGATCCCCATCTGACGATCT
CTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGACCGATCAACCAAGGGGCCAGTTGACTCTGCCGGGAGCTCCACCTCCCCGAGGGATTCAGTCTCGG
GTAGTCGCTTCATACGCCAGATTCTGCCATTCTCTATAGCGACGAGATCCCACTGATACTTATCCAGGCCGCCTGGGAATACCATATTTCGCCAGCCATC
GACCAAATTCTTCATAGTGGTCCAGTCATAGTTTCTTGTCGCTGACATTCGTAGCCTGGAGGTACTGTGATCGACCTGGTCCTTGGATTATTGTAGGCAT
CCACTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCATTGCACCCGATCTGGCAGTTTCTAGGTCTCTCCGGGCTTGATCCAGGTCGTCTTA
TCTGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCGCGTCCGGGAAACACAGTATCCCCGTCCGCCAGA
TCCAGCCTTACCCCGGCTGATATTATGAAAATCCATCCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCCACCCAGATGTCAAACCAATACACCCAAAC
AACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCA
CCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGTTTTTTCATTGTTGATCTTGCCCCCTACCTTG
GCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATTCACGGGACTCCCCGGTTAGCAGATCCATGGATCCCACATCCTCAGATCCACGGGATC
CAGTGACCTGACAGTCTGTAAGACGAGCCACAGTGCCCTCTCCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGAGTCTACCAGAAACCACGTGCCTC
TCCCCTGTAGATACAGCCTGAAGAGACTTAAGGTATGTAAGAGCACTGACGTGGTAAAACCTAGCGATAATGGCAACAGCTACGTCACATACAGCGCATT
ATGCCCAGCATGTCTATGATTCAACAGTCTGCAGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN