Description :
From Genome Similarity Track
Location :
contig_87:86990- 88713
Transcript NameFunction/comments
g10509.t1conserved hypothetical protein
g10510.t1hypothetical protein PHYSODRAFT_249699

Sequence
1723 bases(100 bases per row)
TCAGCGAGTCAGCAAGTGCAAAGGCAAATCTGAGAGAGCGAGCAGAACCCCGAAGAGACCGGAGACAAGTTTCGGACTGCCGTGTGCATGTGTCGGAATC
GTCATCGTATCAAGCGATGCCTGCTTCGAAAGCAGCTAGTTGCCGCAAGTTGCGCTTTTCACAGGTGGCTCAAGTGTTTGATGCAGCCAGGCGCCTCGCG
CGTATCTGCGGCGCTAACGATTGCAGAAAAAGAGTTCACATCGTGTTGTTGCTCGCGAGAGGGTCATCACCACCAACCGAGAGGAAGGATCGAGGCTTTG
GTCCGCCAAGAGGGAAGTGTAGCTATCTGTTTCCCATAAACAAAAACTGAGCCGGAAAAAAAATTGTTCTCGAATTTTCGGCTACTCAACTTCAACCAAT
GTGTCCTCCACATGTCCTCCTCGTCGACCAGTGAAGGACAACAGCCGACCGCTCTGCAACCTTGGCAAGTTGCAGGCGGTCTGGCAGCGTGGGATGACTG
CAAGAGCGTCGAGGAGCTCCGATAACGCGAGTGCAAGCGGAAGGATGCTTTCACTGTGGACGAACGGAGTCTCTCGCGCCTTTGTGGCTTGCATCTCGGC
GTTGTGAGGCTTGGCATCGCATATCCATCTGTCGACCACCGCGGTCTCTGGTCGATCGCCGAGTTGAAGCGCTGGAGCGCCAGCTTCAACGCCAGAGACG
CCATGGGCCTCTCTTGCATTCGACTGAAGCTGGCAAAGATTCTCGGCCCACCGAGTGATGGGAACGCCAAGATAGCTGCAACATTCAAATAGTGAAGGTG
AGTAATTGCAGATGGCTGTGGTTTGTTTTGGGTTGTCGCTTGCGGCAGAGGCAGAGAGTTCAGAATGTGAGGAAGAGAGCGAGGGGGCGCGGGTTGCTGC
GGCGGTTCGCGGCCACTTCTCGCTTGGCCGCTCAATCCAAAGGCCATGAACAAGGAGAACGCCAAGGTGCGCGGCAACCAGCGCAAGCTCACGTTCCACC
GCCGCAAGAAGCCCAGCGCGCTGCAGATCGACCCCAATGCGGCGCCCACGCGCACGAGCACCTTCTTCGGCACGGTGGGCTCGCCCATCAAAATGGGGCC
AGCCCACGGCGCGGCCGGGGCCGGGGCCCGTCGCGTGCCAAAACTGCCGCCCGGCCCACGCCGGACGCGCCCGTGGACTCGGAGGCCGCCACGCTCGACA
TCAACCAGAAGGCGGCCTTCAGAGAGGAGCTGCGCCGCCAGCAGAAGGCCAAACAGCGTGCTGAGCGGGCCACGCCGCCGGCCGAGCAGCCCGAACCCAA
AGAGGACGAGGCCGGCGTGGCCACGGTGCGCAACGACGCCGGCCGCAAGAACCGCGGCCGCCGCAACTCGACCGAGTTCCTGGGCCAGACCATGGAGCCC
GTGCAGCAGCTCAAGCTGGACGGAGCCAAAAAGGCCAAGATCCCGCACTTCCTCTCGGCCTGGTTCAATGCCGGCCACGACACCAAAGCCACGAACGACA
CGGACAATAGCGACGCCGAGTCGGCCAAGACCGACGCCACCATAATCAGTGCAGAGGAAGCGCGGGCCAAGGCGACCAAGCAGGTGGCAGACGTGGCCGC
CGTCGCGGCCAAACCGCCGCCGGCTCCGGTGGACGCGGCCAAGGACAAGTCGGCCGTGAAACACCGGGCCACCAGCTACAGTCAGAACATCAACTTCAAT
GAGATCACTCTAGGTCGCATGAT