Description :
From Genome Similarity Track
Location :
Scaffold_215:8698- 10592
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_215-snap-gene-0.10Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_215-snap-gene-0.14Conserved gene of unknown function

Sequence
1894 bases(100 bases per row)
CAGGTGCTGCGCTTCAGCAATGAGAACTCGTACCTCAACTGGGCGAGAAATGGCGTGCTGTCGTCCGGCGTCGGAGTCGCAATGTATGCGCAGGAGCACC
ATCGTGGCGCTCAACTGAGCGGTGCCGGGCTGCTGCTGCTGGGCTTTGGGTACATCGGCGTGGGCACCGCGAAATATATTTATTACATCCTGCGGTTCCG
CCACGTGATGGAGCTCTCATGGGGAAGCGTCATCGGAACCATTTCCCATGCGTCGATCGCACTGATCATCTGGCTGACGGCCACAGCGTCCTTCCTGGTA
CGACTACATGTAATAGAGCGACGCAATGTGGATGCAATACGCTGACTGGACCATGTGTCACTTGTTCGTTGCCCACAGGAGAGTGTGCCGCTAGAACTGG
ATGCGATGCTGCTGACCGAGCCGATCGCGAGCTACTTACCGTTCCGCATTCGCCAAGGACTCATCGAAACCTACAGTCTCTACCTCGACGACTTAGAACA
CCACATGGATGAACAGGAGCGCGTGCTCGCCGCCATCCAGCGCGAGAAGGATGCGCTCGCAGCCAAGGAGGCGATGATCCTGGAAGCTGTCGCGCAAGAC
GAGTGAGCGAACGGCTGTGGATGTCGCTTTCCCCAGGCCTCTCAGTTGCTGCTGCAGGTTAGCAGTGCGAATACGAGCCAACTCGTTTTGAATCTTCTGC
CGGCGCAGTCGTCAAGGGAGCGTCCAACTCGCTTGCTGAGAACGGTGTCAACTCGCCTGATGTTGTTGTATACACACTCACACCTGCTTAATGGACCGAA
CCACTTGCTTTTCACGTCGGGTTCGAGCTATGGCATGTGCTGCTGCGGCTGATGTTGTTCTGTGTCTTTATTTCATGTGTCTTTTTTTCATTTCCGTCAC
TTCTGATCTCCCCAACCTCCTTCGACAATGATATACCTGTGCGTTACGAGCAAATGGATCCTACAATAAAAAGCAAGATGAAGAGCAAGACCAGCGCCAA
AACGTACAAGATGCGGCTCTCAATGCGTCGCCTCTCACCCATTCCTTCGTTTTTTTCTTTCTCTCATTCCTCTCTCTTTTCTCTGTGTGTGCTGGATCTG
TTCCTGGCGTTAGCGGCTTTATGGGTGCGCGTCTTCCTTCACGGCTTCCTCCAACGGGATGTCGAAATCTGGGTTTCGGCGCAAAGTGACGCCATCCCAC
GTCAAGTTGAGAGGTTCGTACGCTTCTTCACCCTTGTCCGCTTCAATAATAGGCGCCGCCACGAGGATGTCGCTCTCTGGGGACTTTGGCAGCGTGAAGC
CGTGCTCCACGAGGCCCTTGACAATGTCCAGGATCTCCTTGTCCGTCTTGTTTTGCACAAACACCTGCTTCTCCACACCCCAGTCTACAACAATCCAATA
CAAGCACCATATACAGCATCAGTCTCAAAATTCGCTCATATTGATCGCCCACCACGTTCGACCGAGCCAGCCCTCTCTCTATATATAATCCCAGCAGACA
AAATGAGCGCGTACCGTATCGCGCGTACACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGCCTCTCGGTACACGAACGGC
GTGCGCGGGTTCAGCATCTTCAGCTCGCCATAGTTCTTGCGGAAAAACGTGCTACACACACATCATCTCAATCGTCAGCATGAGCGCCTGACCTTCACCT
TCCAGGGTCCAATCACACAGCCACAGCGCCATCAAACATTATAAAAAAAAAGAGAGCCGCAGTACGCACCGCAGGCCCTTGCTGCTCTGTGACGTCTCGC
AGGCCACGAAGCGCAGCTCCTGGATGCTGCGGGAGATCTGCGCGCGCCAACTCATGCTGCTGCTTGCTACTCTCAACTGCTTTCTCACCACACG