Description :
From Genome Similarity Track
Location :
Scaffold_35:86974- 88853
Transcript NameFunction/comments
Hyaar_Emoy2805083hypothetical protein

Sequence
1879 bases(100 bases per row)
CCTGATTAGGAGGAGCAAATACTCGGGATATTTGCTGTTTAAGCATGTACCGTGTGGGGAAAGCTTCGTCTACCGACGTGCTACACGTGAGAGCCCATTC
TCTGGCTCGACCATCTGGTTTTGAGATAGCCATCCCAACTCGCTGTTGCTCCGACCGGAGCATAGCGGAGTTCATGGCCATTTCCACCTCTCTGATCCAC
AGGAGAGGATTCTCCTCTCCTTTTCCCTCAATTGTCTTTACAGTCAATACAAGGGGGCGAGCCCTTGGCTCTTCATCGGGTACGGGGACATACCGAGTAG
GTATAGCCGATGCCAAAGGGTCGTGTACTTGCCCAATCAAAGTGGACTCAAACTGCGTAAAAGCGTCAAGACGTGCACGAATCACGTCAGGACCTTGTGC
GAGGATTAGATCCACTTGTTCGTTCCCGACTAGCGCTCTGATTTTCTCCAGCACTAATCCTTGGGAATCAGAGAGGTTTATCTTTGTTATCATCCTTACA
TAAGAACAGTCTTCAGCAGACTCAGGTGTAGATTGACTACAAGTGCTACCAAGTGTAGCAGAGCTACCTAACTCCTTAGTCAGAGAAGACTTTTGGACTC
GTAGAGTCTTTTAGTATATCAAAATAAGCGGGTCATAATTTAAAGGGTATCAAGTCTTGCAAACTTGGTGAGACTTAACTCTAAGTATATGTACAAGCTC
TTAAGTTTCTAGTCCTGGTTCAGGTGACTACGACTCCAAGGAATCACGTGGCGCTAATGCTCAAGAGTACTTAGCCTTAACTCAGGCACTTAACTCTTAC
GACCAGAGATGTCTTTGAAAGACACGTGTCTGAAACTAATCAAAAGGGGAACTGAATATATTTACTGATTTATAGCGATAATAAACCTTACTTACGTCTT
TAACCTTAAAACTATGCTACCTAATCGAGTAGTTCTTATCGTAGTTCTTGTTGTGTACCACACCAGAACTACGTCACCTCTATGAAGACCCTATTACGAT
AGATATCCTCTAACCATAACCGATAGGGTATGGTATTATCGCTTAGCGTATGTGATACAAAAGTACGCCTTATCAGTTTCACTGATCTCTTTCTGTGTAT
ATCACACCAGCTTACTGAGTTATCACAAGCCGAGGCAATGGAGGAGACGCAGTGAGTAGCTATCAATAACCCTCATTAATAAACTACATGTTTGCTCTGT
TGGCGCAATACTATACTTGCGAAGCACACTGCATTTGTTTGAGGCGTACATGTGCATGCCACATAACACTTATGTATGTTTGTTTGCTTTTCTGCTCAAA
AGGACGCCTTTGGGAGTCCACGGCCGCTAAATACTCATCTAGAACTGACTTTTATTCGTCATTCCATGACAATGTCTGCATTGATGGCATTGGCGTCATT
GTTGTCGTCGTCATTGTAAGTGACGTTTTTGCTGAAGACGTTGCTGTTAGCCGCATTTTTGGGAAATTGTGATTTAATTAAATGTGTTGCACGTACCTCA
TGAACAAGTCTCGCCAAGTTACCACAAGGAATGCATTCATATGATACTGATGTATTTGTTTTTCAATATAAAGACATGATAGTTATACGGCATGTATATG
TACGCATGACGCCAGTTCAGTGTGCCTTTCTAGAAGATTACTGCATCAAAATATCCACTTTTTATCGAATTTATCGACGGATGTTTTATTACTGTGCGCT
CTCACCTTTTGCTTTGTATTGCATTGCCTATCAGCAAGCGCCATTACAGCAAATGCGATCGAAGCAGTTAGACTAAGGGTAGGTATACCAAAGTTTGGAT
GGTATCATCAGGTTTAGATTGGATATGACATACAAAAATTATCAAGTCTGATTTTGATTGGCCAAAACAAGTCGCCGGT