Description :
From Genome Similarity Track
Location :
Scaffold_63:86962- 91143
Transcript NameFunction/comments
Physo_157826absent, small, or homeotic discs 1 CG8887-PA

Sequence
4181 bases(100 bases per row)
ATCGGTCGGGTAAGAGCGAGGAGAGAGTTGTTGCAGCCGACAGCTCACGTAGACACGCCTCGTTGATGCCCCTCTCTTCAGTGAAAAACACCTCCTGTTC
AAGGTATGGCCACGACTGTAGGTACACGGGTTGTCCGGCCAAATCCAAGTTCACCTCACTAGAGATGACGCCTAAGAAGGCTCGTTTCCGGATAGACTCG
ACCTTGACAATCTCATCCGTGTGCAAGCGCGTATCGCCGACAATCGTGTCGCTAGCTGCAGACTTATTCGGGAAAATAGACAACGCCGAGATGACACTCT
CCGCTTCATAATTTTGACCGGTAGAAGAGCTAGGCACTGGAACTGAGCTGCCCATTGCCTTGAACGTGATGAAGTTCTTCACTCCATTCTGTGTAGGAAT
TGTTGGCGCAAAGCTCCTCATTCCCGTCGGTACCGGTGGTGCAGCGGGTGTTACACTTAGAACCGATGGAATCATCGGGGTAGCAGGTACGTTAATCCAA
AGCTTCAAAAGCCGAGCTATCCGCTCAGAAATCTCCACATCTTTCTTGTCTTTGGAGACAGCAAACTGCTCCATATCGAATTCACTGGAGTCGGAATCCT
TCGTTTGCTTTTGCTGCTGTGATGCCTTTGACTGCTTCTCCAGGCGCAGCCATCGATCTTTCAGCTGAGTGCAGATCGACAAGGAGCACTCCAGCAGCAT
TCGTGCCTCAGCAGCGTTCGCTTGCAAGTCCAGCTGCGGCAAAAAATCGGGCATTCTGGCAATAGGAGAGGCTGAGCTAGGATTCAGCGCCTCTGTAACA
GCAGCGCTCACGTACACAACGCTGAGCATAACGCATTCCACCGGAGTATGCGTCCAAATAGGCAATGGAAGAGCCTCCGCGACCAAATGCTTCGCTTCTT
TCTGCACCTCCGGCGGAGGCAGCGAGGAGAGAAACGGAGTTACTTGTTGAGTAAAACCGTTCTGAGACAGTGAGATTAGTTTCTTCGAGCTCTTGCGAGT
TGTGAGGAGGTCAAGCAACGCGTAGGGGTCTTCACCAGTTACGTCATAGTGTAAACCTTCCAGTAGTTCACCTTCTGCCTTGACGAGGTGGCGCTTCAGG
ACTCCGAGTTCTGGTGAGGCAGCCGTGAGACGTTCAGCGGCTGCCGCGCCGTGCTTCGCTTTGTATACTTCCTTCACAAAGGCCGTCCACGGCACTTTTC
GGGCGTGAGCCTTCAAGAATAAGTGCAACATCGTCGCAGCGTAGATATCCACCTCCATGGGCATAGCGTGAAACGTGAAAAACCTGTTTAGCGCGATGAT
GGCACTCGTGGCATCCTCCCGGTCAAGACGCAGTCCCTTGGCGATGTGGAAAATACTCTTCACATACTTCACCCGCAAAGTTTCCTCCAGCGATGCAGAG
AGGACTTGCTGGACCGATAAATTCTTCAGTTCTTCTTCAGTAACGAGCCAGTTGAGCTTCCGTCCAAAGCAATATGGATCTTTACGCTCCGGAACCTGCG
CGTTCTCCTTCTCTTCGGACGGCGATGAGTTGCTCTTGTCAGTGTTTGCATGTTGCCGCATCATCTGCACTTTGTTCTTCTGGTAACGGAAATTTTCCAG
TTCCTTTGCACCTGCTTGGTACACTCGTAACATTTTGTCTAGCAAATTACGGCGGTCCAAAGTCTTGCGAAATGAAGCCGCCAACTCGTTGCTTTCCAAT
TCCACAAGCGCCCAGCCCGTACCGTCTAAAAAGTGAAATACATCCGCATCTACCAGTGCGTTCGGGTGCTTTCGGCTGAGAAACAAGCTGCGCAGCGCAC
GCGCGTCATACGCCTTCGGCAAGAACTTGATCAGCAACGTTTTGGATATAATTTTGCCGTCGCGGTCGAGCAGCTCCCCGTACTGGTTCTTCTTGACCGT
ACTGAAGCTGCTCTCCAACTTGGCCATCGCCACAGGAGGCGGTGTACCGGCAGGCGACTGCGACATTACTTCCCGCTTGGGCGACGGCTCTCGGCTCCCG
GCGGCACTCGACATGCCCGACGAGGTCGGCAAGTGGCGTTTTTTCGGGATAGCGAACACTACATCGCCCTCCTTCTCCCCCGGGGGACAGAAGAGCTGCC
ACCCGTTCTCCTTCAGCTGCACATACTGCTTCTCACCCGGTTCCTGCTCCTCCTCGGTATCATTTTCATCCGTCTCGTACCCTGCAGGCTCCAGCAAGTC
CTCCACCTCGTACCTGTCCTGTTCCTCGTCATACGCCTTAATCAACTGCACATCGTACTCCGTCTTGTCGTCGGGCGACAAGAAAACCCGCACGCGCTTC
CCCACCAACGCCCGACCTGTGTCCTCCTTCTCCGGGTCGCGGAAGTATCCCGTCTGGGCCTCCGCGTCCTTGAGCGCGTCGTTCTGCGTGCCAATGACCC
CCTTGCAGCTCGGCGCGCCGCAGTAACACTTGATCTGCCTCGACCCGAGCGCCTTCCACTGGTAATCGAACGTCAGCTCCTCGCCCACTTCAATGTCCCT
CAACGCAATCACCGCGATCCTCGTCTCGCCCTTCACCGTCCACTTCTCCGTCTTGCAATTGGGCTCGCAGCTGTGGTTCACGAACCGCGTGAAGCTCCCC
TTATTGCGCGCGTCAATGTAGACCCCCGGGGCCAATAGCAAGTAATAGAAGTTGAGCTCGTGCCGCGGCACGCTCTTGAGGCGCCTGGCCAGCTCCTTCT
GGTCGATGATCTCGCCCACGTACTCGCCCACGATGCTCAGCTGGCCGATGTGCTGCCGCGTGCGCACGCCGTAGCCCTTGTGCTCCGTCTTGAACGGCTC
CAGCTGCGGGTACCGCTCCGGGTGCTGCAGCCGCTGGTTGCGGCAGTACTGGCCGGCCGCGCAGGACGGCGAGCACTCGACGTACGTGGCGAAGTTGAGG
CACGACACGTCGTCGCAGCGGCGCACGAGCTCCTCGCTGCGCCGCGCGTCCTCGCGCTCGACGGCGTCCGGGAACGTGCAGAAGCACAGCGCGCCGTCGT
CATCGTCGTCGTCGTCGTCGTCCTGGCGGCTGGCGCGCGCGCGGCGCCGCACCTTGTCGCGCGCCAGGTGCCTGAGCGGGTACTCGTTGCGCTCGATGAG
CTGCACGTTGCGCAGCGCCTGCAGCTGGTCGAAGCTCGTGGTGGCGTCCGCGTCCTGCTGCGCCTGCTGGGGACTGCGGCTGCGAGACCGCGAGCGTGAG
GAGCTCCTCGCCATGGCTTTTAGTGGCCTCGGAGCGACGAGTTAGCGGCGGTTTGAAAGGGGAAACGGCGCAATCGAGTGACGAATTGCGCGCGGGGTGG
CCTGGAGTTGACTCGCCTGTTGCTGCCCCTTGCCTGCCGTGGCCCAAGGAAGGCCCTTTGACTGTGGTGGTGTCTGGGCTGCGCGGCGAGCGGACACGGG
TGGTACAGTGTACCGTTTTCAGATTACGGGATCGGGCGAAGTGGCGGACAAGAGACGTACATTTGGTGGGCGCTCGACATGTAGGCGACGCTACGTTGTG
GTTCTACCTAAGCTTACGTGCAAATTCGTTGCTCTACTTACACGTTGAGTAGAGCGGCGATGGCGGCTGAAAGCATTAGGGCTGCGACCGAAGCGGCGGG
CGTTGACGTCGTCGCGCCGGATTCCTTGGCCGTGCCGCTGCCCGAGGACGTGAGCGCGTCCACGCCGTTCGACGGCGTGCGCTTCTCGCCCACGGACGTG
CTCGAGTCGGTGTGCGTGTACGAGTTGGCGCTGCTGCCTTTGCACACGGGTTGCAGCGCGGTGCACTCGAGGATGGTCACTGGGTCAGTAAGTATAACAG
GGGATTGGTCAGTCAACTTCAACTTGTGTATACGAATCGTGTCGGTGGACGTACCGTTTGGCGTGGGCGGCAGGTCCGTGGACATGGTCTTGGGGCAGGA
CAGGATCTTGGAGCGCGTCGGCTTGAAGCTGTCGTGCGTGACGGTCGAGTTGGCCGTGGTGGTGTACGCCTTCTTGAGGTTGTCGTACTCCGGGTAGGGC
GTGAACTCGCACGGGATCTTGTCGTGGTCGCAGTCGTTCGGCTCAAAGTACCCGATGCCGTACTTGCCAGCGTCCGCGGTCTTTGTTAGCGCTGCAGCAA
CACATCACTGTTAGTTAGGTGGGAGGTAGTCGTGGGATGTAGGTAGAGCTCAGCGTACCATCCTTATCGATCAGGTTGGTC