Description :
From Genome Similarity Track
Location :
scaffold_10:86945- 96092
Transcript NameFunction/comments
g657.t1 conserved hypothetical protein
g658.t1 cyclin-H, putative
g659.t1 hypothetical protein PHYSODRAFT_505690
g660.t1 hypothetical protein PHYSODRAFT_504907
g661.t1hypothetical protein

Sequence
9147 bases(100 bases per row)
TTGATACCCTAAAACGCTGCTTCGCCTTTCAGCCTGAAAGGCAGTCAACAATGTCTGACCGTCAGGCTGACGTGGGTGCAGGGTGCAGGCCCAGAGCGGT
GGTCAATACATGTACTGCCTCATGTCGTCAGCGCGAATACGGCATGACGGCAGTATCTACTGGATAGCCACCGCACAGCGTGTTATGTGGCATGAACGAA
TTATATGCACACGTCCATGTATATCGTTCATGCCACCATTTTTGACGAACCGCACTGGAACAGTTTTACCACAATCTTCAGCTTCCAGGGGTTGCTTGAA
CATGTATGCTCTCATGAAGCGATTACAGAAATACACGCTTTTTGACAATTATAATTGCGATTATTGGTGTGACGACACATTTTACACAGAATGTACACCA
GGCAACCAATACACCACGATGGCGAGCGTTGACGCTGGTGATGCGATGCCTCGCGCTAAGCGACTGAAGCTGCTACGCGAGGCAAAAGCCCGCAAGGAAC
GCGGCGAGAGCAACAATGGAGAAGCGGGTGAACTGGTCGCTGAGGCCTTGAAACCCGCGAATGAGGAGCCGATGCAGCAGCAGGAAGAGGCGCAGCAGCC
GAAGGACCTAGAAGAGAACGTCGACATGAACTCCTCGACCGACACCGGTGACAATTCGGAGAACCTTGTGGAGAAAGTTATGAAAGTACAAGAGGAAGAC
GCCAAGACAGAGGACGAGAGTGACGATGAGCTGCTGAATCTCGCTCCCAAGCGCGCCAACTGGGACATGGAGCGAGATATCGCGCCTATGCTTCGAAAGC
TCGAGCGGCGCACACAACACGCCATCGTCGAGATCCTTCGTACGTCTTGCAAAACTATTGTCATACAAAGTTAGCGAAGATCTGACGTATTGTTTATCTT
TGCAGGTGAAAAATTGGCAGCAGAACAAGAGGAAGGAAGTGGCGAAGAAGAAGAGGAAGACGATGAAGAAGACGAGACAGAGGAGGTAGACGAATAACAA
CATCCGTGCCGAGTGCAATCCTATGTTCTATGATATAACGCTTCAGTGCTCTGGCCCATTCGCAGTAGAATCTACGCATTTAGGCCTTATCCTTTTTCTG
CTTCTTCACTTTTTTCTTGTCGTCCTTGGATCCATCTTTGCGTTTCTTGTCCTTCTTCTTTCCGTCGCCCTTTTTGTCCTTCTTCTTGTCTTTCTTATCG
TCGTCCTTGTGGAACTGCTTGAGCTTCTTGTAGATCTGTTTGACCTGCTTGGCACGACGGCGCAGCATATCTTCACCGCCCTTCTCTTTTTCTGCTTTCA
GCGCTCGGAAGGCTTGCGTAATCTGCTCCAGGCGACCGGATACCTCGTCTACAGCCTGGTCCTTTGAGAACTTGCTGCGCTTAATATACTCCAGAACATC
AGCACTCGCGAGTCCGCAGGCCTTTTCACCGCTACTGGCAGCTACGTCGTCCGTCACGTGCCACAGCGCTGCTAGCGCCAAATGCGACGGGTAGTGCAGA
AGCGGGAGGTCTGTAAGCAGCATGTCGTTAAGTAGAGCTGTCGAGTTAGCGTGTAGCTTTTGCAGGACTGTCGCAGCTAGATCCTTGTGGAGTATCTGCT
TGGCGAAAGCTCGGAAGTCATCCAAAAAGCCGAGCAATGCACGGAATGGGTGGTACATGATGAGCTGGAAACGTACACCCTCCAGCAAGATCATCTCATG
GCCAATGATGAATTTGTGATCCACGTGGAGCTGGTCAGCGACTGTATCCACAGACATGTACTGCTCCTCGACTTTACCAGCCACGTAAATTACCGTCGGA
ACGAGGTATTTGGGGTGGAACTCCATCACACTGTTACTCAGATAGAACCTCTTGAACAACAGCATAGCGCAGCACTTCACCTTGTCCGATGTGCGCAGGA
ACTGAGCACTGCAGCTCTCCTGGATCTTCTCCTCGTAGAAAGCTCGAAGCAGTGCCTCCTGATCCGAGTCCAGGAACTCAAGTAGTTGCGTGAGCTGCAA
ATTAGCCTTCTCCTCAGCCTCTTCCAGTGTTGATAGCTCTACATCCACCTCGTCGTTCCAATCGAAGGCGTCACGCACAGCCGTCGACGAGTGTGGCAGC
AAAGCGGCGAAAGACCGCGCCTTGCGGGCGGTGGGGGCCGGCGCCTCGGGCTTCTGGGCCTCCTCACGCTCCAGACGCAACGCCCGCTTGGTCTTCACAT
GCTGGAGCCTTCTTACACGCGCCAGTTCCTCCGTCGAGAAGACCCAGTTGTTGAAATGCGTCGACGTAGAGAGATACGACATTCTACTAATGTTTCTTGC
TTTTGGCTGTGGCTTCGGATAGTATGAAAGTAGATAGGTTCTGTCTATACTATAGCAAAGGTTATGTATTACACATCATGTTGAAGCGGAGCTTTTCAAG
CTGCTCATCAGTTTGACATTTACGATGTGGGCCGCACGTCTCCGTTCTCCGTCTCGAGTGGCTGTGGGAGCTCGGCGCTTCTCGTCTCCATGTGTGATGA
CGGCGTCCAAGGTGGCACTACAGCAGCTGCCGCTTGTGGACGTTTCCCCGCTGGTGGAAGCTGCCAACAGCGGGCAAAAGGTGCCGCCCGAAACCAAGAC
GCAGATTCTAGACGCCATGCGCTCTGCCTGCGTTGAAACAGGCTTCTTCACTGTGCCTACAGAAGGCGTTCTGTCAAGCCGCCTGATCCAGGCAGCGTAC
CGTCGAGCGGACGAGTTCATCGCACTGCCAGACGCTGTAAAGCAACAGTATCATTGCAAGCGCTCGCCCAATGCTCGAGGATGGACGCCGATGTTCGAGG
AGCCGTCGGTACGATATTTGAAGAAGTTATGGCGGTCAATTTGCTATTGGTATTAACTGTGTAATTGGGTTGAATGATACAGTACCAACCGGATGTGGTT
TCGCACTTGGAAGGCTTTGACCTCGCCCGAGAACTTCCTGAGTCGTATGTCAAGGAAGGATCAAGTTTGGGGCCGAACGTCTGGCCAGCTGAAGTACCAG
GATTTCATGAAGACGTCTATGGGCTGTATGAAGAGACCAGCAAGCTCTCGACAGTTCTGTTTAAAAGTTTTGCTGAGATGCTCGGACTCCCAGCCGACAC
GTTCCTGGTACCTCTTGCTTTTGCACTTGTAGTTCTGGAAAAAGTTGTACTGACTGGTTGCCGTTCGGTGATTTGAAGCAACACGTGGACGAAGAAGCGG
AGGCGTTCATGCGACTGCTGACGTACCCTGAGACGGATGCCCACGTGAAGAATTCGACAGTGGGGATCGCTTCGCACACGGACTTCGAATGTTTCACGAT
TATCCATCAGAATGGCGAAGGTCTGCACCTGTTGAACCGCCAGGGCGTTTGGGTTGAAGCTCCGGTGTGCGATGACAGGTATGTAGGGAAACTTGTGCTA
ACTTGTACTGTATTACTTTGGGGCTCACTGTTGATGTACGATAGACTCTTTGTCATGGTTGGTGACATGCTCGAGCACTGGACTAACGGAGTTCTAGTCG
CGACTGAGGTACTCAACAACGCAATCGTGTCGGAAACAAAATTTCTAACTTCATCAATTGTGCTTATCTTGTGCAGCATCGTGTTTGCAACTCAGAGAAG
AAACGCCAGTCTATCGTGCGCTTTAATGGCGCAAATGGCGACACCGTCGTTGAGCCGCTTCCTGCGTTCGTGACCCCAGAAAACCCACCTCGCTATGCGC
GAATGACGCAGCGGGAGCACATTACCAATCAGATCAACCTCGCGGAGCAACTACTCCAGAAAACCAAGGCAGCAGCGCAAGCGTAAATTCAAACGCAAGC
ATTCCTCAGGTGATGAAAATGGGCATCGTAGTACTTCCAGCACACTACTTAAAGAGGTTAAGCTTGAATAATTGTTCTACTTTCTCAGTGCCGCAAACTC
TAGGAACAACTTTTTCGAGTCATCATTGCCCATGAGATCTTCTCGGGTCGGCTTCCGTCCGTTCTGAGCCTCAAACTCCTCACGCCACTGCGTTAGAGCC
TTCTCCACCCGCGCCAACTTATCCGCGCGAGTCTCCCGGACTACCTCGACAGGGATACTGTCCAACATAGGCTGGCACAGAACGCTCATGATGTCGCGCT
TGTCAACAGTTCCATCGGCAAGTTTAGTCATCTGTGGTAAACAAAAATTCAGGTCACTATCAACGTTCCTCCTGCTGCAAATACCCTACTCACCTTGACC
AACTTCTGCTCTGCTCCAGCACCACCCAGCGGGATCAACAGCCCACCTCCAGGCTTAAGATACTCTAAAAAGCTCTCTGCTTCCGCCTTGGCTTCCACCG
CAACGCCGATGTGGATGCAATCATACCGACCATCAGATGGCAGGCCAAGATCCTTCTTCCCTGTGCTGATAATAATCTCCGTCTGCTTGTCCGCTGCCTC
CTGGCCCAGACTGCGCCTCAAATTCTCCTTTGAGAACTCCACCAATTCTGGAACAATGTCCACGCCGGTAACACATCCGTTTGGCCCCACTAGGTGGGCC
ATTGCAGCCACAAGAACGCCCGAGCCACACCCGACGTCTAACGCCGTCATGCCTGGCTGCAAGTGCGGCTCCAGCAATCCCAGCACCTGCGCGTGCTGCT
GCGGAGTGGAGATCGTAGCCACCGTGCCGATCTTCAACGGGCGATTGGCATATCGTTCGTTTGAGTCCCGGAAGGCTGGCGCAACGAAGTCCCCACGGTC
CACACGCCTCAGTGCCGTCTCCAGTCGCGAGCCGGCAGCTACAACATTCGTCCGGACTAAACTGTCCACCAACGCGTCGTGCGAGTCACCTCCAATCTGG
TGACCAATGCTGGTACTAACAAGGAGGTCTTCGGAGATACCACTCAAGACGCTCAGAGCTCGACCACTGACGGCGACACGCGAGCAGCTCCACGACCGGA
GCAGCAATGACATCGCGATAGATTGACGAAAAATCTGAGGTGGAAAATAAAATAGTCCCAGTATTTGTAAAATAGTCCTTTTGTTACGATTGGTTAGATG
GCTTTGCTCTTCTAGAGGAAGGAACATTTGACAGGCATGATTCTCGTTGTCTCGGTGTTCTACACGATAGGGACGGCCCAGGCGCCGTGACTCTCAATAT
TGTAGACGTTAGCGCCTCTCTCGACGCGGAAGAAGCCGCGGTCGCCCCAGTTAGTACCGTCCGAGTTGCGGGCGATCCAGTACTTGATACCCGACTTGGT
GTCGGTGCCCCAACCAACAAGACTGACTACGTGGGTCGTACCGGGGTACTGTGTTGAGTCACGGAGGATGTAGCCTCCCTTGAATTGACGGTATTCCGGC
GCCAATGAGTACATGCTCACGACGATGGGGCCACGATGGTAGATCTCGTTCATCGCCTGGAGCTGGAACTCTTCCGATGTCGTGAAATTGAGCGTGCCGT
ACTCGGAGATTCGGTACTTGACTGGATCTTCCAAGACGAAGCACTCGCCTTTCAGGTTGCATGTGTGGCATTGAGTCGCAGCACACTCACCTCCTCCCAT
CCATGACGGGTGAGACGCGATGTACGGGTTGCAGGTCAAGTCTACAATGCCATTTTCGTGGATCCACTTGTGAGCGTGCCGCGGATCTCCACCATGACAC
GACCCGAAAGAACGCATACCACAGTCCAGTAAGACTTGAGGAGACAGCAACACCTCCGTTTCCAACCGTCCAGTCTTCTTGAACTGCGCGATGCGAATCC
GATCCGATAGAGCACTGATCGTAGCGAACGCCCAGCAGGACCCGCACGCACGAGGCACCATTTGATTCAGAACGCTGGTTGTCAAGCTGATGCCTGTTCC
GTTGTAGTCTCGCCAGTCCCAGTTTTCAGGGAAGTTGTCGAACGACGTCACTTCAGGTAAGGATGTCAAGATGTGCTCGGGATCGTTGCCGCCGAGGAAC
CATCCAGCGCCCTTGTTGGTTTGAACTTCTGTTACATCACCATCGCCTTTTCCGTTGGATGCACACGCCGCCATCAGGTCGAGTTGGTTCTGCACAGCGT
GCATCGATACCCCATCATGTGTGTAGTCGACCAAAGGTTTGGATGCGAAGAGTGTCGAACTCACGAAGCTTCCCAATGCGATCCACCCGATCACAGACCC
AATGGAGAGCAGCTTGAAGCGGTCATTGCGAACACCATCCAACGTCGATTGCAGCAGCGATGTCGACAACGTTGACGTTTGCTGCGAAACGTTGTTGATG
TTGAGGTGCGTGCTGGTGCGAGGCTGCAACAGCGGAAGGTCAGACTTGTCGGAGATCACCATCGCACTGCCAGACACTGGAAGAGAAAATTGTGGAGTGG
TGTGCAAGCTAGCGGTGCCATGTTCTCTCGGCAGCGAGCTCCTCTCGACTGTTGGAAGGACACATACACGTAGGATGGATACATTCGCGACGTAACTCGA
CGTAACTCGCTCTGATTGGCTAGATCTTAGACCGTGGCCAATCAGAGAGGAAAGAATGGATGTGTCGATGTTGAAGCCGTAACGGTCAGGCATTATAGTC
GCCGATGAGCATTCTTCCTCTGACCTTTTTGCTGCGGCATAGCAACTCCACACCCCATGCCATTGATACTGTTGGCAAAGCGCCATGCCACTAACAACCT
CCTCTTGCCACGCCACACTTCTGGAGACACATAGCAACTCGACGCTGATGAATTCCTACCGATGGCCTTGTCGACTGCTTCACCCGCGTCCCAAAGTGCT
GCGACGCCTGCCCAATGGTCTGAAGCTGCAGACTCCAGTCACGCTACGCTCGACTGCGCTTCTTCCCATGTCAACGGCATCCTCCGATCACTGCAGTGAA
TGTGTACCGGTATTGATAATTGCTGACGACGCACTTGAACTCGTTTTTCGCAAGAGAAAGTCGGGTGGTGACGAAGTCAACGTCTTCGATAAGGTCAACT
GATCAGCTGCATGATGCACGCAACGTAAATGCAGTGTATTATGCACGAGATCAACCAGCCAAAGGGAGCAGTCGGTAAGGAATACTCCAAGATGCAGGTA
TCTAATCTATTTTGTTCCTACACAACAGGAACTGCCCACGCACCTTTGTTTTCAATGTTGTAGGTGTCAGTGCCTCGTTCAACACGGAAGTAGCCACTGT
CACCCCAATGTGTACCAATGGAGTTGCGCACAATCCAGAATTTGATCCCCGTTTCAACTTCCGTACCCCAGCCAACAAGACTAACGACATGAGTCGTTCC
GTGGTACTTCCTCGAGTCTCGTAGAATGTAACCTCCTTCGTATTGCTTGAATTCTGGGGTCAACGAGTACATACTCACGACAATTGGCCCACGGTGGTAA
ATCTCGTTCATCGCTTGGAGCTGGAATTCCTCTGACGTCGTGAAATTCAGAGTACCGTACTCCGAAAGGAAGTACTTCTTGGGGTTTTCAACCACAAAGC
AATCCCCATTCATGGTGCAAGTATGACACTGTGTGGCAGCGCAATCTCCACTACCGATCCACGACGGATGCGACGCGATATACGGACTACAAGTCGAATC
CACGATACCGTTCTCGTGGATCCACTTGTGAGCGTACCGGGGATCTCCACCGCGGCAAGACCCGAAGGAGCGCATCCCGCAATCAAGCAGGATCTGAGGG
GACAGCAGCACTTCTGCATCCAACCGGCCAGTTGTCATGAACTTGGCGATGCGAATCCGATCCGACAGCGCGCTGACGGTGGCAAAAGCCCAGCAAGATC
CACATGCGCGCGGAACCATTTGGTTCAGTACCGTTGTCGTGAGACCTATGCCCGTATCGTTATAGTCACGCCAATCCCAGTTTTCAGGGAAGTCGTCAAG
CGAATGGACTTCTGGCAGAGCTGTCGTAACGTGTTCGGGGTCGATTCCACCGAGATACCATCCGGAGCCCTTGTTGGTTTGAACTTCCGCTGTTGTTGCG
CTGGTATTGCCGTTAGTTTCTTTCTGGAGTGTGGCCGTGAACAACATTGAGGAGATGATAGCCCCTACTGCAGTCCAAAAGAGTACGGAACCCCCTAGAA
AGCGAGTAATATTCTGTACTGGTGAAGGCGACGATGATATACCACGCGTGGTGAGCTTGGGCTTGGAGACGTTCATCATACTGTTCATGAATTGTTGTGG
GAAAATTATGGAGTGAGGAATGGCTGAACCACTGGCGGCGTACGATGAAGATTGGATTTATAGATTGGCTTTCAATGCACTTTTTCAACTCGGAGGCGAG
CCAATGAACACTGGTAGTGGTGACAACGCATGAGGATAATATAACGCTTCTCGAGGTGAACTTCAAGAGGCAGGACAAGTGCGTTGATGATTCACTTCAT
TCAGAACTGTGTTATCGGCAATTCGGTAAGCGGGCTGGTGGGTGTCTCAACCGCAATTTCAAAGCTTCAAACGAAAAGAAAACCTGTCGCGGAACTGCAT
ACGTTGGAAGCAAAATGGAACATCCAGAAAAAACTATCACTAGTCCTCGAAATCGAGACCAGGGTACATCTTCTGCTTCACAACTGCAGCAGGGATCGGC
TTCTTGCCCACGACGAAGAAGAACGGGATGGCTTGTTTGCTCTTCGGAGAGAGCATCGCAGTCCAGTGTCGGCCAAAATGCTCCTCAGAAATCTTCATAT
CCGCTTGCACTTCCAGTGGCCACTTTATCTCACTGAAAACCCCATGCAACGGGTCATCTTCGCCGTATTTCATGGCCCGCTTCCCCCATTCCTCACTGTC
GGCCATAGTATGACCAGGGATATCCGCCCAAAACTCACTCCCAGGAGCTGACAGATAATTGATAGTCTTCAGTAGTTCGACAATGCTGGGGCGTTCCATG
TACGGGATCAACCCTTCCACGGCCCAAAACGTGGGCATTGTCGGGTTAAACCCGTGCCCCATCAAGTTCACCTCCAGGCCAGCGTCGGCCAGATTCGAGA
CAATGCAGTCAACGTTCTGAGCCACAAGTGGAGCGTGCAGCTCCGTCATCACCTCGGCCTTGTGCTCGAATACTGCTTCCCTCTGGTCGACTTCCAGAAC
GTGACAACCGCGAAGGGATTCCAAATGGTACGCACGGGCGTCCAGTCCAGCTCCAAGTATGACAATCTGTAGAATTCTTGGGTCACGGTGGAGAAGAGCT
TCATCCAGATACCGTGTACGCAAAGCGATGAAGTCCTCGGGTAAAGA