Description :
From Genome Similarity Track
Location :
Scaffold_1081:8694- 10569
Transcript NameFunction/comments
Phypl_g12305hypothetical protein

Sequence
1875 bases(100 bases per row)
TTGAGCGATTTCCCCGCTCTCTCGATGGAGACCATCaagagcacgcgctcgacgaTGCGCTTGCTGAGGCGTCCCTCGTCGGGGTCCACCGCCATTTCCA
GTACCTGTAACGACCTCGTGTGCTCCTGGGCCGTCGAAGTagcagccgcagctccatccacCTCTTCGGAGGGGAGCCTTATCTCGACGAACGTGTCGTT
TCTCTTGGAGGTCACTGCAGCACTGGGTAAGCATGGGTCGCTTGTAGAGGGTGATGAAGCTTGGGACGAACATGAGTCGCGCCGCTTGTGCGCTGTCACC
GCCTGGAGCTCGCTggtgagcagcttggcgtagTCAGCCTTGGTGTGATACGCCTGGTACTTCTTGCTCCGAACgcgcacgcccagcgcctggcACAGTG
ATCGCACCTCCTTGAAATTGCACGTCAAGATCGTGTCCCGAAGCTCCTCGCTCTTGTTCTCGGCGCTCAATACGCGCAAGAGTTCCAACGTCACTGCCGA
CCCACTCATGCTCGTTGTTGTTTGCAGGCGGCGCGGCGAATTCGATTGTGAGGGCTCCGTGTGGGTGGCTTCAACAGGGCAACTGGATTTCAGTAAGGCG
AACTGCAAGAAAAAaattgggggggggggggggggggggggggggggcaatACGAATTGTTATTAGAGAAAGACAACCACTAAACGCAAATGCTACTACC
CTGCTGGATCTATTTCCCCCGTGTCGTCTGCTTCCACTCGGAGTCGTTTGAAGCTCCGCGCCAACTCGGCTCTGATGGTCGTCGCTTCCTCTGATTTCGG
GTCGAACACATTACCCTCCGAGCAGCGTCGTATTCTCCTTGATCGAAGGCACCAAGTCCGCGCGCTCTGTATTCCTGGTGGGGCCTTAGTAGAGCTCCAT
CACACGGTTCAGAGTGGCGGTGTGCTGTTGTTCTTCCGTCTCGGTAGCGGTAAGGTAGGGAGCGCATACGTCAtggtcgaggagctcagtGCCATCTCGA
GTGGaaggcgcagaagctgcagcggctgtAAGTTCCAGTTGAGATCCAGGTAGTACACCTCGCAGCGGCCTGCGCAGGTGTCGTAAAAACTTGCGTCGCT
GAAGCCAGAAATGTGCAGATCCTCGCCCaagagctgctccaggtcACTCAGGTCGAGGTTCTCAAAGCAGCTATCCAAAAAGTGCTCCATGTTCTGCTCC
GGGGTGTAGTTCCCAGCGTCATTCGCCCGCTCGAGCACTGCGGTCATCGCCTTGGGCGTCATGATGTTGCTCAAACGCAAACAGCATTGTGGCTCGGTCA
ACATAGGAAATGGAGGCGCTAGGTATGctggcagcttcttggtaATCTGCCAAATGTAGTCCGCCTTGCTCTACTGGCCCTTGTGTTGATTGCCTCTCGG
GCTCTAAGCCAACTCTGGGCACAATGCCACTAGCTTCGAGACTTGGCGCTTGTTgagagcgtcgtggagcccttcgttctcgtcgcgcagGTTCTGGAGG
AATTCCAAAGTTACGGTGGATCCGCTCGTGGTCGTGAATGTTGTGGTCGTGTTCGTAGGTGGTGGAGAGAGAGTCCGCTCCGTTGGTTCTCACGATAGAG
CGAGCTGCAAGTGCACATGGATAGCCGTTCATATAATGCTGCTTGAGATGGCAACCTATGTGCTGTCCTTTTCGTCGTCTGCTGGCTGCACCGCGGCGGC
AAGCCATCCCAGGCTTCGAATCAACTCTGCATCTAccatcgcagcagcacgcgagcCCGGCGGGAAaagctcttcagcagcctGTTCGCCTTCTCGATCG
ATGCCACATTGGTTGCTcgcctcttcatcttctgcgGGGCCTTGACACGTGTTTCCCACACCTCTGTTGATtgct