Description :
From Genome Similarity Track
Location :
Scaffold_7:869398- 877277
Transcript NameFunction/comments
Phyin_T30-4PITG_05159Putative uncharacterized protein

Sequence
7879 bases(100 bases per row)
TTTGGCGCAATAGAAATACCTTTCCTCGGGTGCTTCATTGGGAAGCGAGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCTATCGTGGATTGGCCGGTTC
CCAAGAATCAAAAGGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCAAACTACGCGGAGATGGCTCGACCATTATCAGATCT
CCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTTTCCAGGCTCCGATCCTTGCGCTATTG
GACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTCGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTCAACG
CGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAATAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTAAGGGTACA
CCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACACACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTT
TCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTC
ATGTCACGACAGTGATGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGA
GTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAG
GATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGA
AGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTTGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACGAAGTC
CGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAG
GCAGGAAACACGGGTATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGC
TGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAG
AGTGCTTGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACAGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGC
GTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTCGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCT
ATGTGAACGGCTTGGTTAACCCTCGAGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAG
CCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGATATGCAA
AAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAAGGTTTGAGGTCGGGGACCAAGTTTTATTAAATGCAAAAAACCTACCTACTCATGCAGTGT
CTGCAGTCTTTAAGACAAAATTGAGACCACGGTTCATAGGACCGTTCAAGGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTTAACCTTCCGAAGAAGAT
GCGCACGCATCCAGTCTTCTACGTTGGCTTACTCAAGCCGTATCAGGACCCTGCTCAGGTGAGCGCGGAGGCGTTTGGCGCCAACGGTGGCTGGGCCACG
ACAGGCTGCGCAACAGCGGGAGGCCGAACCACGGCAGGCTGAGCGACAGCAGGTGGCGGGGCCACAAGACGCAACAGCAAGTCGATCTGACCTTGCAGCT
GAGCGACTTGACGCTCAGGGTCCACGACTCGGTTCTGAACGAACTAGGGTTGGTCCAAACCAGTCCAACGCGGTGGTTCGGTCTCCTTCGGGACCCTTCT
GGCAAGGGCGACTTCAAAAAGTCCGGTCGGTATCATGGAGGATCCTGGGTTCAGGGAAACCCCAGAGGATGGCTCCAGCCGAGAACCCGTACACCTACGA
AGTCGCAGCACGGGAGAGTCTCGGGTAAAGAACTCGACCCTCCCTCCCATGGTGCAGCTATCGAAGAGTCAACGAAACGAGACTCTCGCAACTTCCCATG
GTTGGAAACATCCCAGGTGTGTAGCAATGGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCATTGCAGTGTGAACGCTACCGGTTCCACTAAGGACAGAGCTGGTGTATAACGACAAAGTAATACATGAGCACGGGCAAGCGACGTCA
AAATCTGGTGACGCTGCGGGTGCAGATAGCAAAACAAATGGCATTCGGCTCCTGGATGTGGCGTCGCTATCGAAACGCGGATACGGTAATGAAGACCGAA
TTGTGGTGGACACCGACGAGAACTTCCACTTGTTCGCAGTCATTGACGGCCACAACAGCGCAAGAGCGGCCAATTTCTTAGTCGAGAACCTGTCTAAAAC
TTTGACTGAAGTTTACGACAACGGCTTTGACCATGCCAAGCTGTGTCAAGCGATGGAGGAGCTGGATCGGATGTTTTGTGCATTGGACACGCCGCCATGG
AATATAGGTGGGGCGTGTGTACTGGTCGTCCTCATGTATGTTGACCCGAATACCGATGCCCCGCAGAAAGTAGTGCTTAATATCGGTGATTGTCGTGCTA
TTATTCGAGAGGCGCCGGAGTCTATTGCTGGGAAGAACGAGGCAGAAGATGAGCCTTCTCCAGCTGCTAGCGTCGTCGCCCTCTCCGAAGATCACTGCGC
ATCCAACGAGAAGGAGATGGCGCGAGCTCTTCGCAGTGGGGCCAACATTCTAGGCAACCGCATTGCAGGGATCTTGCAGCCCTTCCGGGTCATCGGTGAT
GCGGATTTAAAGGGCCCCGACAAGAAGGATTGGGTCATCCCTACGCCTGAGATCCATCAAAGCGAGTTACTCGTTGGTCGCAGCATCTTAGTTATCGCCA
GCGATGGCGTTTGGACGGTTCTCGACAATGACTGTGTGATGAAACTGGCATTTAAGGAAATCGGAGCTAACGGATCTGCTAAATCCGCTGCTGAAGCTAT
CGTCGGTGAGGCAGTCAAAAAGGATAGCGAAGATGACATCTCAGTCATTGTGGTCTCGGTGTAGGGTCACAGGCACCACCAGTATCAACGACAAAATGAT
GACTTTCGATTTTAATTTGTTACTTTTTCCAGAGAGGAGGTCGAACACAAGGGAGCCGTACACAACCCAGAGCAGATTGTTGATAGCTCCAGCGAGGATC
ATGGGGCAGTGAGGCCGACGACCGAGTTTGCAGCACCACTTTGATCGCCGAGAGGTAGAAACAACAGCGGTGATGCCGACTACTGCCTTCATGGTGTTCT
CATAATACGACGATTCGTTTTATATGTGACGAATTATCAATGTTATACTACAAAGAGGTCGATTTAAAATGGTGCTTTACAAGAAAGTTCTTCTTGCAAA
TCTCAAATTAAAACAGGCGCCTGTACCAGTATGCCCGATTTTAAAAAATTAGACCGGTAGTTTTTACAAAATGGATAGCTGAAAACCCATTGTAAAGGGC
TTCGATCTGTACACCACTATGATGACAAGTTAGCGTGCCCGCATCTCCACCGCGAACCGTATATTGCGAATAAGAATGCAAATCAAAATAATTTATAGAT
AAGTTAAGGATAGCTTGCCCCACCGCTGACAGCAACGGAGGAAATCAGCAAATAAATTCCCGGGCCGACAGCAAATTGATTGAGTTTGCTGTCACGTTTG
CTGATCAGCGACGCCCCGAAAGAATGGTGCTTAATGAAATCCAAGTCGTACATCGTATTGCCATCGTCAACTTCCACCGAGAACGCGCTTCCCGCCACCC
CAACGATCGCACACGGTGCTCTTCTGTGCGAATCACAAAGAAGCGCTTTACCATCATTACCTCGAGCCGGCGAAAAGGGGAGGAATCCCCGCTCATGTGG
GAGGCTTTGATCTCGTGTATGTGATAAACATTTATTTTACACGCATATTAGCTTTACCATTTACCATTATATATTTGATAAAGAGATCAGACTTATTACA
CGTTAAATTAATTTGAAGAACTCTCTACCAGCTGCATTATTTTCAACCCGCCCGGCCTGGTCCGATCAGTAACGCTCCACTGATCGCTAATTGATAATTA
TGTAAAACGCTTTAGGCCATCTTACTCTTTGCAAGAACATTTTTGGTGTAATTATAAATGAGCCATATCTGAAGCATTATCAGACAGACCAGATGATAGG
AGCCGTTCAGTAAACCCGATTAAATATTCGACTGTCATAGACATCTTTTTCATAGCTAACCACCGGTGACTTATGACACAGGCACCCCTAGAGCCTCAAG
CTGAGGACATTCATCACTGCAAACATGTATCAAAATCACACCCTGCAGTCATATTTTAAAGCAATGTCTTTACCGTAACGTACGTATGAAATCATTTTAC
AAATTATGTTTTACTTATTATTCAGTGTTCAATAGAATACAAAGCTATTACATGTAATAACCGTAAGCTTAGATTCAAATCGTCATTAGGGCATCTCCCC
CGCGCCATCATTATCCCGCGCTAGATACCATACCGGTACCATAGAGAAATGTTTGTGTCATCACGGCTTCTTCGTGCAAAACACGACTTTGTTATAATTT
GTCACGGATAAAACGAATCGTTACATTATGAGACCTCTGTAGAAAAGATAACAATCCAAAATAGAAATCTTCATAATTATCATTTTGTTGTTGGCACTGG
CGCTGTCTCTGAATCTACACTGAGACCACAATGACTGAGATGTCGTCCTTGCTGTGCTTTTTGACTGCCTCACCGACGATAGCTTCAGCAGCGGATTTAG
CAGATCCGTTAGCTCCGATTTCCTTAAATGCCAGTTCCATCACAGTCATTGTCGAGAACCGTCCAAACGCCATCGCTGGCGATAACTAAGATGCTGCGAC
CAACGAGTAACTCGCTTTGATGGATCTCAGGCGTAGGGATGACCCAATCCTTCTTGTCGGGGCCCTTTAAATCCGCATCACCGATGACCCGGAAGGGCTG
CAAGATCCCTGCAATGCGGTTATCTTCAATCGTGGGCCCACTGCGAAGAGCTCGCGCCATCTCCTTCTCGTTCGATGCGCAGTGATCTTCGGAGAGGGCG
ACAATGCTAGCAGCTGGAGAAGTTTCATCTTCTGCCTCGTTCTTCCCAGCAATAGACTCCGGCGCCTCTCGAATAATAGCACGACAATCACCGATATTAA
GCACTATTTTCTGCGGGGTATCGGTATTCGGGGCAACATAAAGGAGGACGACCAGTACACACGCCCCACAACTTTTCCATTCCAATGTACAAAACATTCG
ATCCAGCTCCTCCATCGCTTCACACAGCTTGGCATGGTCAAAGCCGTTGTCGTACACATCACTCAACGTTTTAGACAGGTTCTCGACTAAATAATCGGCT
GCTACCGCTCCGTTGTGGCCGTCGATGACTGCAAACAAGTGGAAGTTTTGGTTGGTGTCTACCACAATTCGGTCTTCAT