Description :
From Genome Similarity Track
Location :
Scaffold_734:8691- 10939
Transcript NameFunction/comments
Phypl_g10640hypothetical protein

Sequence
2248 bases(100 bases per row)
GCTTCGTGCTCTGAGCACACCCACATAAGTCGATTTGAAAAGCCGATAACTTAATATACCTCGCTCTTTACATGTACCTGCTTCGGCTCGCTAGTTGAAG
ATGAGAGCGGGCCGACGTGGCTACAGATCCGCCGTACCCTCAGTGTTCAGTGCTcagcggccagcagcgcttcctggtcgagcgcgtcctcgtccagcat
gagcgagactcgtcgcttcttggcgttcgtATTGTTCAGGATGGACCCGCTCTGGTAGTCCACCACGTTCAGGGCGATGCCCACGAGGCTGCCCAGCACG
CCGAACgacacgaacagcagctccacgcccggGATGTACCGGTCATCGTGGTTGAATtcggccgccaccgccagcggGAACAGCGCGAGCCCGATGTTCT
GAAGATATACATGTGCACAGCGCAAACGGTTAGAACAAGATTTCGGAACGTACACACCCTGAGGCACATCGATGTCAAGGCATTCAGCCTGGATTTCGGG
TTGCTTCATATGGTAGTCCGACGCTCGCGAACGGGGTACGCACCTGTATGGCAGTGATCGCTCCGTACGCAGTTCCAACGTGCTTTGCCTCGACCACGTC
TACATAGACAAAGGTACTCGATTAGATTCCCGAAAGCTCGCATCCAGCACGAGAGCTTCGCCTACCCTACTCGGAAACTTACATGGGACGGAAGGCCACA
GCGCTGCGGCGAACACGCTGTAGGCGACGCCTTGCAGCACCAGAGGCACATACAGCGTTACTTCGGTCAATCCAAGCATGATGTGGACTGCCGTCAGCGC
GAGTGGTGCCACCAGCGCTAAAATGGCCCGGAGACCGATACGGTCCACCACGAATCCGAGGAACGGGGAGATGACCGCGCTGATAATGTACGGAATGGAC
ATGGGAGTTGCAGCCTTTTGGGCTGCGTCGGTTTTCGTGGCGCAGTACAACTCGGTCAGGGGGCCAAGCTTCCATGCCTCGTCATCACAATTAATCGTGT
CGCCAAGAATCAGCGGAGGAGAAGTCGAGCAATTCCACTGGTCCAGCGGCTCTTTGATCGTGCAATTCGCCGATAACAGGGGGAGTGGCCATCCGTAGGG
AGGAACGCTAGGGCAACCCGGGGTGATCTCTCGGCAATCGATCTCATAATTGTAGAGTCCCTCGCCGCATCTTCGGCACAGTTCAGGGGGTTCTTTAAAA
AAATCACGCTCCATCAGGAGACTGCTAGCAACGTTGTTGAAAGGGATCACACAGCCATAGACCACCAAGCAGCTTAGCGCCAACAGCCAAAAGGCAGGGC
GGAAATGCTTGACATCGCTGAAGTGAATACTctcggcagcagccaccCCCTCTTTCTGGTTCTGTTTCGCCATCTTCTCAGCTCGCTTGTCGATCGGGAT
CACCAGTAACACCGTGAAGGTAGATGCCAGGCACATGATCACACCCACCCACAGCGCTGTCGACACACTCGACGCTTGGGCGACAACCGGACTCAGCTCA
TTGTTGATAACACTTCCCAATCGAGCAACACTGAGATTGATTCCCaaagcgagcgcaagctcaCTGTTCTTGAACCACGAGGCGACGAGCGTCCCCTGCG
CCACACCGAGGCTTTCTCCACCGAAACCGAACACCACTCGGCCGAACTGCGACCCaaaagaaaaagaagaaaaaaacgTCAGTCCAACTCATTGAGCATC
AATGGATCGCCAACGCCTCACCAGCATCATGTTGAAGCTAGAGAGCGAGCAGCCCGTTGCAAAGATGATCTGCCCCGTCAGGATGGCCGTCGAGAAGGCG
AACAGCATCACCCGCGCTCCAAATCGAtccacgagcacgccgccaAAGAATGGCAACACGATATTGGGGATCGAGTACAGCGTGTAGAGCAAGTTCTACA
GTCAGAAACGTGCACCAATAGTTGTTCTCTGTTATTCGCAACACGTTTGCAAGGatctttcttcttcttgctggcaAAAACTGCTGAGAAAATGAGATCG
AGGGGTTAAGACGATGTTGAACGTACAAAGAGGAACTCGTAGCGGTCCTTGGGGATGTTACTGAagtgctgctgtagctggctcttgagcgccgccggGT
TGTCGAAGCAGTAATAGTTGCCGACCATCAGCACGCACGACAGGAACAGCACCAGCCAgcgcacgcgcagctcgctcttctccgcCATCTCTGGTCTTTG
GGGGGAAGGATACCACAAGTCTGAGTCTGGATACTCGTCTAAGTACGA