Description :
From Genome Similarity Track
Location :
Scaffold_131:8691- 10659
Sequence
1968 bases(100 bases per row)
AGCGGTCTACGCAGCACAAATTACAGAAGAGATGGTAGAGCCTGATGCAGACATCGTTGCCGAGCTGATCAAACAGATTCATCAGCTACGCTACGACTAT
CCTATGGATACTCGAAATCTTCTAAATTACCCCGGTGAAGACACCGTCACGTTTTTACCGACGGAGGATGAAATTTTCATCCATATTTGTTTTTCTAAAG
AGGAATAAGGACAAGGTGTTGAAGCCAAAGAGTATGATGATTTCAGAGAGCAGGCATCAATCAGGCTGCGTCAGGTAGAGGCTTCTTTGGAAATTTGACC
TCTTCATTCTTCAGCAAGCTGACGAACAATCAGAGCATCTAGTAATGGTGCGCAAGATGCAGAATGCAGTGGCCAAGCTTGGAATGGAAAGACAAATTCA
AACGACTCTGCACAGTTATTTTCCCGCAAGTAGCCTCTTCTTTTTAACAAATATCAACTGCTAAAAGCTGGGGCCCGTTAAAACCTTATTAAGTATTAAG
AAAGAGGGGTAATTAGCTAATCTCTCTCGCCCAACGTCGAGCCGAACTTTTGTCATTAACTACAAGGGGTTATTAGCTTATAGAGGATTATCTAAGAGGG
ATTTTACTATAGTCCTTTGCTATCACTGTCCAACCGAACCCTTTTCCGGTCGGTGTGCATTGCAAAGACAGCTAACGCCACCATAGTATTGCACTTGGAC
CTCGTAATGGCGTTCCACTGTAGTATGGGTGAAGAACAAGAAATGCATGGCTTCGTAACGTGGTCATAGATAATTGTCTTGGTCTAGATAAGCAGTTGAC
ATAGATCTGGAAGATTAGCTCGTATCAGCTCCTCCAATTCCGGAACGGTCTCTGTAATGGCCTTTGTATTCTGTCGACTCGCCTGACCCTCCGAGATTGA
TCCATCTGTGAAATCAATTAGACTTCGACTTAAGCATGTATGGTGGTTTACACTTGCAGTATTTTTCTCATTTTACCAACTTGCGTGAGAAATATAGGCA
TACGACGACACGCAACCGTACCCGCTACCATTTCCACGATGACTGCCTATTTATTATCCGAGCCTTCCCGAACTTGATGCTTCCCTGACCTAGTAGCAGG
AGGTACGCAAAGCGCTTTAAGACGTGCTATGGCCTCGCTAGTAAAATCAGAGGGGCCAGACATTAAGGCCTCGAATCGCTATATCCGTTTTCTGAATTGC
GGAGCTACCTGACGTGATAAGATGTCTCCTGATCGAATTAACCTAGCTCCTAGTTCAGAACTGCAGCTTGAAACAACTTATACTGGCTGGCTAGCCTGCA
AAATATCTTTTAAAAGGCTCACTTCGTGTTTAACAGTTCATGCAAAATTGAAGTCGCCGATCCATTTCAATCGGAAAAGATGGCGTAACCTTAAACGAAG
ACTTGGTCGAACACTCCTAACAAGCTAGCCGCTTCTGCTCCACTGAGAGTGTGAAAACGCTTCCTCTCCGCTTCCATTGCCTCCAAACGAACCGGTACAG
CACGTTATACTGCGCGAACAGGTGCCGGGCCGTTGTATACCATGATTAACGGAACTGAAACGGGGTAAGTCTACGATTCCTTCGACTAGCGCCATGAAAT
ATATGACGATGGTTATTAGTACTAATGGAAAACAGGCTCAAAAGTAAACTGCTGGGTTCCAGCTACCTGAGAAGTAGTAGAGGCTGACGTCTCCTTGACG
CTGCTCTGTACAGGGTCCCGGTTTCTCGGATGACCCTGTGTCATAGACTAGCATACTATCCCGTAAGAGCTGCGCCGTGTGCCCATCCGGCCACCGCATA
TCTAAGGAATTACATCTGTTCATTTATTTGAATCCCTCTACGACCCCTGCGTAAAATCTCGTCATTTCTACTACCATACCTCCTGGGTCGGGCGTTCGTC
GCTCTGGACGTCGGCTACATTCTGAGCGTCTTTGGTTCGTTCCGTTGCCAAAGAAGGAGAGCCCACTG