Description :
From Genome Similarity Track
Location :
Scaffold_307:8691- 10564
Transcript NameFunction/comments
Phyra_85771Hypothetical protein

Sequence
1873 bases(100 bases per row)
GCACTTTCAATGTGGAAAAGGTCACGGAGTGTACTGGAACTCATTCCTTGAAACTTGCTGTCGCTCCGCTTCAATTGAGGTCGCGTAGGGAGTGGCGTAC
TGTGAACGGCTTCTGTCCTCGCACCCGTGAAGTCATCACTTAGTACTGTTGGAGTAGTATTCATCGGGGCACCTAGCAGTGGGCGTGGAGGCAAATAGGA
ATTCTCACGAATGATAGCGTGACCCTGTTCTTCCTCCTCACTCAGTGCACTTTGCAAGAGCAGCGGGTGATGATGGACCACCATGGTTTCAGAAGTACCT
GCGCAGTCGACGAGTGCTTCACTCTGAGCTAGAGTAACCAGCATGATAAGCTGGTTGTACTCGATTCGCATATCCTTTAGCTCAAACAGCAGTCGAGCTA
CGCTGTTGAACCGGTAGCTTGACAGTCGTAAACCACATACTCGCAGCACCACTCGCAAGTTCTCCATCCCAACGGCACCCGAACGACTAGGATCGTGTGC
CTTTATTTCCGCCTGTAGATCACCGATGGACAGCTTCCTTGCTTGCATGCTCTCCCATAATAATACAGCAAATTCGGAGCGCAGCTCTACGATTTCGCGA
AAGTGGTTCACTACCTCACTCAACGTGATGCCATCTACCTGGAAAACACTGCTGACAAGGACAAAGTTCCGAAATATACGCGGCTGAAAGAGCAGGGAAT
TCAAAACTAGCGGCAGTGGAATTGCAAGCACCTCGACAAGCCTCGAGTCTGCGTAAACGATGCTTACCTGGTAGAGGACGCATTGCACTACCAAGGCAAG
GTAAAACCCGTTGAGCATTAGCAGCAGCATTACCGTGAAATGCCACGACTCGCGTGAAAACCAGGGAATTTTGATCGGCGGGGTCAGCTCACAGTTTAGA
CTGCGCTTCCTTTCACACAGGCTCAACTTCGGTTGTCTTGACAACTCATGTTGTTCTTGTATTCTTTGCATGCTCAAAAGGGCTTTGTCTGCATCTTCTA
GCGTCCACGCGCGAGCTTCTTCACGCGCAATTGACTTGAGATGGCTTGTTAGAGTAAGTTGGTCTTCTGATAGCCCTCCAGCTTGCAGTAATTGCTGGAC
ACACGAACGGAAGTAAACCAGGACTACGCCGTGCAGAGCCAATAGCACCCAGGAGAACCCCACCAGCACAAACACGAGACCACGGCGTCTCGTCAACTCT
GGTTCACCACTGCTCAGAGCTGCGGTGATCCCTTCCAAGCACCAAGCCACAACAAGCAGCACTCCCCACATTGGCGCACCTACGTCGGTCATGTGTGTTA
TCTGGTTATTCTGCGCCTGCCTCAGGTACTTGGCAAATGGGAAGAGCTGCGGCAGCTGGAAGCGATTGAGGAACAAATGACGCAGCAAGCGAAAATGTAT
CAGTTCCTGCATGTTTTGCGTCTGATTGACACTTGGTGAAGCCACCGCATCGGCCAAGTCCTCGGTGGAAAGCAGCTCGGCACGATCCGCGCGGACGTTG
TGCTTTCGTAGCAGGAGGAAAATGCAGACCGTTTGCAGGATGAGCGCGAGCGCCAGGATGAAGATGGTGAGGTCGGCCACCTGGAAGGCCGTCATGGCTG
CGCTGCCGCTGTCCACGCTGGGCGCCTCTTTGATCAGTTTGAGCACCAGGCCGATGAGTCCGAGGATCATGAGCTCGCGATACGCCTTGCTCAGCAGCTG
CTGGTACTTGGCGGACACGGCGGCGCGTCCTTCGAGGTGATGTAGCGCACGCTCGAACAACAGCAGGCACGCTACCAGGACGCTCAGGTGTAGCAGCACA
CGCCAGAGCTCCACGGCATCCCCCACACGGAAGAGCGACGTCTTACCTCCCATTATGCGAAGATGAAAATAGC