Description :
From Genome Similarity Track
Location :
Scaffold_437:869- 10588
Transcript NameFunction/comments
Phyag_g5695Di-N-acetylchitobiase, putative
Phyag_g5696hypothetical protein
Phyag_g5697hypothetical protein
Phyag_g5698hypothetical protein PHYSODRAFT_543861

Sequence
9719 bases(100 bases per row)
GCGTAGAATTTACAAAATGCTGCCAGGATTTCGTGCATGATTGCGACAGTTCTGTATGTCAATATCCGGGTGCAAATTCGATATGGATCCTTGACGGAGC
TGCAACCCATTGCCACCCATAGATTGTTCACTACCTGCGTAGTGTTGGAATCGCTCCAATCTTCCTCCCCGCATATTGCCTCTTTTTCAATCCCATAAAA
TTCCTCCTGTTCTGGGTGGATGCATCCTTCTTGAAGTCGTTCAGGTCTTGTGCCTTGGTGATAGCGACGCCATATTCGTACACCAAGAGATGCACGGTTT
GACCTCGTGTCTTCGCGAGCCACTGGTTTCATGCGTGGTCGGACTTAACAGTGTCTACAGTGCGCTTTTTCAACTTGAACTGCATTTCCTTCTCCCAATG
AGCTACGTGTGGAGGCTGTGTAGACCATACGCCATCGGATTTCACCGCTCGACACATCACTCGACAGTTAAATTGGTCCCAGAGGTTCTGTATGACCTCC
TGGAAGGAGTCTCCATTTACAACAGCGTTGTCGAGAGTGGTGCCAGAAGGATCGCGTTGCCCAATAGTTGACTTAACAATTGGACAAACCAGAAGCTGGT
ATAATTGTTCTTGCGCGGGCTTTGGAGTTGAAGGCTGCGCTTCTGTGGGAAGAGAACTCTCTTCAGTAGTTGAACGATCTGGAATGGGGTATGGCGCTAC
TCGGGCTCTGCTTCTCTCGCGCGGTATTGGTCCCGATACCGATGATGTCGGGGAACCTAGTGGCGTGAAGAGCTGTGTCACAGAAGCTTGCTCGCTCTCA
TCAAGGCTTGACATTGCACTCGTCAATCAAAAGGAAAGTGGAAGTCTAACCAGACTTGGATTGAATCTTCACTAACGTCATATAATATATTCTTTTTACT
GATTTGGCCGATTTTGTGGTGTTTTTACCTCGGTCGATTGAACCAATCCCGTTCGGAAACTTCGATTAGAACTTGGCCAGAATTTACAATATATATTCCA
TATTACGATTCATGGGTGAGAGGGAATAAGCACTTAGACTAGTGAACAATAGGACTTGGGGAACGTCTTGTATTTCCAATGAGAGGGTATTCCACTTTGA
GGGGATCATCTGTGTTCACAAATAATCCTGCCAAAAAAGCTAAGTACCAACGTTTGAGTTTTGCTATGAAACCGGCAAAAACGGAAATCAAAAGTTTTCT
ATACTTTAACTGCCAAAAGCAGTGCGTCTACGCGCAGCTACTGCATGTATGCCAATCAAGCACGAGTGCGTTCTCCATCGCTCGGACCATGAGGAATGCA
TCGCAATGAGCATCGGGTGCGTGCACTTTCGCCGCCTGCTTCCTCGCTACGGTCAAAAGCGACCGTTTTTCGCTGTAATAGTGTGGTGCACGCCGATAGA
AAGGTAgaaagttgcagcagtccGAGCTCACCTCATGGTGACAAGGCTTCGGCCAGCGCTCTCCACATGAATCTTGCGTCGTCGGGCGCCGAGTAGTCCA
GCGTGTCGGCGTTCCACATGCCCACGCCACGCAGTCCGAGCTCCCGGACGAGCGCGCACTTGGCCTGGAGACTGCGCGGGTTGTCGAACCAAatctgcga
ctgctgcgccTCCCTCACGAACGgggtctgcgtcgtctcgtCCCATTGCTCGCTGAGCCCTTGGCGCTTCACTAGTCGCCGGATGTCTCCGTAGTCGATC
TGTCCACCGGCCGCATCACTGCAAGGGGCGCCGAAGAAGGGCACTGGTCGGATCTGGCACCTCGAGGCGTCCTCAATTGCCCGTTGCTGTTCTAGACACG
GGTAGCGGTAGCCATACCACGGCACCCCAAGCACTAACTTGTCCGATGCGATGTCGTACGCGAGCAGGAACTCTTCCAGTCCTTGCCTcacgagcgccag
cggcGAGTTGGCGCCAGCTACGCACGCGTCGTACACTTGGCTGCGCATGTCGTACGACATAACAAACAGAAAATCCGCGGCGGCCGCGAGCTCGCGCCAC
GGGTAGTAGCGGCCATCGATGCCACGAGGGGCCCAGGGAACGTCGAACGTGACCTACATATATGGCTGTCAATGGGGTCACGACAAAGTCGGTtgcgaag
agcagcaagaataCGATACCTGCGCGTTCTTGGTGAGTGcgtgctgctccagttcgtGCCGCAACTCGTGTACGAGCAAGCCGAGACACGTTGACGTGGA
TCCGTGCATAGGCTTCTCCGTGTCAATGTTAACGCCGTCAGCGTAGTTCTCCACGATTTTCGAGTACGTCGTCTTGGGGCAGAGCAAAGAAGCGGTAATT
TAGTGAACGATTCGCTACCAGGTATCATAGTGTGTCACCGTCGATCCTACCTTGATCCAGTCCTGACGCGCTTTGACGTCGCACAGTTGGTCCACATTGT
CAAAGTTGTGCTTTACCACAACCTTCACGCCTTTACTGTGTGCGTGGCAGAGCAGCTCTTTGTCCTCATTCCAGGCTACCGTGGTGAGCTGGTCCCAGTC
GTAGTGCTTCCACCGGTCATCCGCCGCCACCGAGAAGGCAAAAACCTCCCTACGAGGGCGCTTGCCAGCAAAGTCCACGGGCAGACATAGAGACGCTGAG
TAGAGTTCGTCACTGCAAGGGCAGGCGTGCAGACGAGCTCGGTCTTCCTGCGTCAGACTGTCCTCCAACAGCTCCGCCGCGTTGTACACTGGGACAGAGC
GAGAGACGCATTCAGTTGCCAGTACtagtaccagcagcagcagcacagccgCAGCAAGCGAGGGTAGACGCAGAATCATGCTCTTGAATTTTGGGTACAT
CGTACCATTCCATCTGCAAACAGAGGGAAAAAGATCGTGCGCAAAACGTATCTTTCGGTGGTCGACCTCTTTGTGTCCCTTCATGCGCACAGTTGCAGAA
ACGAGTCTAGTGAAAAACATGGCGGGGGCTAGCAATGCGCTCATGATGAGCATGGGGACGGTGGCTATGTGGGGGTTCTCGCCTGCTTTTGACGTGTACA
GCGGCTTGCCGGAGTGGAGCAGCCAGGGTTTTGCAGCTTCGGTCGCTTCGAGTGACGCCACCGCACCGATCAACATTTTTCTGGCGGGGCCTGGGGATGT
GCGCCACGTGCTGGCGACTATCGtgcgccgccgccgatgGGAGCCAGCCATGAAGAACCGACCAGTGCACATCTACTTGTTTGAAAAGGCTATCGAGACG
CTTGCGCGAGACTTACTGTTGATTCAAATCGCACTCGACACGAATCTTCCGTTGcggcagcgctgcaacaCGTTCCTGGAGATCTTTGGGAATGCTCGGG
TGCAGGTAGGTCGTCGgggtggaagaagagcgatgCAGCAAGGGTATTGACTGTGGAATTGTGATGTGCGTGCAGGAGAGGACGAGCGCTTACATCGAAG
AGcaggcgaagaagctgatAGATTTCATCTGTAATGACCGCGGTCCATTGACAGGCCTAGTAGATAATTCACACTTGAAGATGCGCACTCACGACGATCT
CATCGACGTGTTCCGAAGCTGGTTTCAGAGTGTCAAGTTTGATGGTATACTGGAATTTTTAAGAACGGAAAAATTGGCTCTAACTAACCGTGTTCTGGTT
TGCAGTTGACTCCCTTCGGGATCATCGCCTTCGACACTACTACGAAGTTCGCTACGACTATCGCGACAACCTGATCGACTGGGACTACACCGTACATCGT
CCTTAAGCCTTGTGGATTCCGATGCTCTGGTGCTCACTCTTGGTTTGCGTTCtagatgaagctcaagaaaatTGAGAATGCTAGTGTGATTCACATTCGA
CAGTATCGCGATTGGAGAAACTCTGGCGTGGCATTTGAATTCGGCGATCAGACCTACATAATGCCAAATCGCACCATGGCAGCATACACAGAGGTACATG
GTCGCTGTTTTAGCGTCGATCGTGTAAAACTCGTGAGTCTCATTCTGATACGTTTTCTTATGGACAGGCAACGAAGAAACACCACGGATCTGTGCTCTGC
AGAGGCTTATGGACAGACATCATTGTGAGTCCATACATTTCGTTTGGTGTTCACTGTGAGAATTCCAGCAAATTTGTAGAGCAGCTGTTCGAGATTCACA
ACAAGGGCACGGGAGTCGAACAGAATCGCCATGTAAGTTATAGTTGTCTATCCCGCTTTTACTTCGGTCTTTATTGACGAATTTGATGTAACAGAACACC
GGAGAAGTTGCCATGTACAATGTACTATCGTATTTGTACGAGATCGAGACTGGCAACAAGTATCAGATGGAAAAAGTACAGAACACCCTTCAGCCGCGTA
TTCGTTTGCATGCACTAACGCTACAGATTGGTATACTAGGAACACGACATTTTCAGCGGAATTGGCGATACGGAGGGAGCACGCGCTGGTACTGGCAATC
TGCAAGCACCAGATAAGCCAGTCCCGCGGTTCGAAGAGTTGGGTGAGGACACTACCGAAGCGTAAGTGCAGTGTTGCGTCTTTTGATTTCTGTCATATTG
GCAACTACACTAATCAATTTTCCTGGGCAGTGAAATCTTTAAGCAGGAACCAGCACAGGCTACATCTCAACAACGTGTTAAAACGACCCTGGAGGGTGTG
AAGGTGGAGGCTACACTTTCCAAGCACTTGCAACGACAAGTTTTCCTGACTGAATAGTGTTACTTTGTCTCTATCGCAGATCATTCCGTTGACAGGTAGC
CTGGAGGACCTTTTTTCAAAAAAGCGCTACACCAACCTATTCGACTACGCCTTCGTTTCGTCCCAGCAATGCCACGTGTTTCAACCCCATGAGGACGTGG
agcagcaaacagcaagaaTGTTCACAAACATTTTGAAGGATGGTGCGACTGTAGACGTTGAGTCTTCAGTGTAAGTACATCTTATTATTATTTGCTTCCG
TATGGAGCGACGATAAATATTGACGTTCCTGGGTGTACAGCTTCATGCTACCTCTCAAGCAAGAGCAAAGGACACACTATGTGACGAAACTACAAGAGTG
GACATCACACCATTCGCTGAAGCCCACGTTTGACTTTGGAGGCAAGAATGAGCCTTCCACCGAAGACATGATCAAGATTAAAAACGCTGTGCTACGGTTT
AACTACAGCGAAAAGATTGCATGAGTCATCAATTCCTCAGCGAATGCTGTGGGCTAAAAGTTTGCATGACTTTTCTTTTGAGCAAAACATTGGATTTATT
GTCTACGCTAACTTCTCCGAGTCGTGGCAGAACTTGGCTGGGATGAAGCGTTTGGGAGTCTACTGCTGGTTTCAGCTCCGGCGATGGCGACATGCATGAT
TGAACTTGTTTTAGGTGACAGGTGAGGGAAGTTGGCGTTTGTGTTGTGTTTTTAAAAACGAGacctgcttctcctttcACCGGTTTCCACAACGGTCTTA
CGGTCAAAACTAAGAGTATGCGTTCACGCAAATCATGGCCACGATATGCTTTCCACTGTGAACTCCACGATGGGGTATCCCGATAGTCCAGCCATACTAC
ATAGTTCTCAATCGCGGATAATACTGGGCACATATACGCATGTTACTTCATCCGCTGCCCCTCCACCCGTTGGCTTTTCACTCGCTGGCTCTTTCTTCGT
TGTTTCTTCGTTTGCTGTCTGTGGCCACGAGTTCGTTGCTTCTTTGGATTGATTGctttctcctcttccacaCCCCCAATGAGCTGTCTCTTGTACCGGC
TTTGTTCATATTTCCTGCCTCTGAGTTCATTTTGAGACCGTGCCTGGTCTCCTCGATGAAGGAGGTCAACAGCAGGAAGCAAttttgtgctgctgggtgg
CTCATGAGCACTACTCACAGTTACCGCTCTCTTGCCGATCAtttgctgaaggagcaactGAAACTGTTTAATTACCTCCGAAGACTTCGCCCACGTTTCG
CTTGGCAAGATGGTCCACTGGTATGCAATGCAACAAGCCGGATACGTGAGTTCCAATTCACCAGAAAATCTAACGCGACCATAACCTCCAAAATTCTGCG
GAAGACCTGCACAACGACCCCTGGTAGTAGAGTTGAAACCATCTCCACAAATTGAACAAGGACTTACGAATGCGGTGAACACCGAACCAATAACGTCGAA
ACTCTTCGTCACTCTCTGGAGCGTAGCGATGGAATCCCTTTTTCCCAAAGCTGCGGATCAGCACTCAGGTTAGCTATCAAGCAAAGAACATTACACTCGT
GAAATCTGCTACTAGAACGTACCTAAGCAATGGTTGGGCTATTCCTTCTGGTTTCGCATCTTCGACACGTTGTGTCTTGTACTCGATCACTTCATGCTTC
TCCCGTTTATGCCCTGCAGACGGTTGGCATACAAGAGTTTGACCGTAATGCGAAACCAGCCAGCCTTCACCCAGGCGGGGCATCACCATCACAGAGCCCG
ACGTGGGGGCGAAGTAAAGTGGATCGTACCCTGGTTGACTAGGATCTGTGGGCTCTGCTAGAGTCCTCAACATCATTACCTTCGGCATGCATTCCTGTAA
CACAAAACCCAACTCAGTtaagctgaagaagagggaaATAAACACAGTAACCACCTCTTACTAGCTCAATAACAGGACGTCCCTCAGTATCCGTGACCAG
CTTCACACTCAGAACCGCAATGGTCGGTGCCTCTCCAGAGCGGGGCTCACTGATCATCAGAATTTGTGGTGCCTGGTTCCTCTTCTCGAACTGCAGACAG
CCATTGGACAGGagctggaacttgagcaccGTTCTGATTAGGATGTCGAACACCGTCGacactgcagcatcagcagtgAGTCCCAAAGGTTAGTTAGGCT
TTATGTATGTCAACTACAGCACTTAGGTGCCTCACCACTAGCCGCGAGGTTAACGAATGGCTCCATCCTCATGTGAACGTCAACGCCCACAGACGCCGCC
AGTTGCTCCATCTTCCCACTGATGATCCCGAGCGTCGAGTCGTTTGGCACCGGAGTGAAGAGCTCCTTCTTACCGTATTGCAATGTCATAATACCTGCGA
GAATTCCCTGCTCCATGAAGAGGTtggccatctcgtccaccgcgtTGAATAGTTGACTGTCGTGGATGGTCAACACGACGCATGGAATAGGATTCTCCGA
CGTCGGGGggtgacgcagcagctccagtagcgGCGCTAGAGGCCCTGGGGGAGGATTAGAGCCTTCAGCGAGTGACAGACGCACCGAGTAgctctccagc
gacgccatgtCTGTCGTCGCAAACACGAGTTAATTATTTTTACCCTTTCGTCTTCCACCACGGCTGACTCGTGCAGCGTCGATCTGGAGGCCTATACAGA
CCACACCAAGCAGACGTAGGTCCGTCCGAGAGCGTTGAAGTGGCCTTGGCCGCGCGAAAGATACTTTAGGTGCAAGTGTTGtcgcgcagcttcacgcGGT
TTGTTGCGACGTGACAGCGAGATACTGCGAGGGTTCCTCTTggaagcagccaagaagatACCGGTTATAGTGTCACTTGCACTACGGCACGCGCTAGGCC
TCGATGAGGCCTATGTAGGGTGTGTTTTGGTGGATCTCTACTGCGCGGTCGAAGGCCACGCCAAGGCGCAGCGTCGCTACAGTAGTAGGGTTTGCAATTT
AAACTCGACCCCTTTTTTTGGCCCAAAAACTCATGAGTTCAAGTTTTGGGGCAAAATTTAAGTTGCGAGATGGACTCGGAGGGCTTCACGTCTCGCGCGT
GGCTGGGCCACTGGGTCTCTGGGGACGACGAGCCTGTGAACAATTACTACGAGGACCACAAACTTATGGAGGGCGCGCTCATCAAGATGGGGGACTACGC
GCACTTCCGCTACTTTCTGCTCTTCCGCAACGGCCGCTTCTGCTATTACGAACTGCCCATGCCAGCTGCGGCTCCTGGAGGGGGGGGAGGACCCGAGGGC
CCACGTAGAGTTCACCTCACACTCACGTCCAAACACCTGCGCGGCGTCATGATGCTCAATGCGTCAGTGAACGCGAAGGATTTGGCCAAGAGCGAGGACG
AGTACGACGCCGACCTCATCAAACGCGGCCTCGTGTTCAaccgcaagaagctggagatgcaACTCACTGGATATTCCCCCACGGGGCAACTCatgagctg
gaagctgcgggCGGGGAAAGACGCAGTCTACCTCAAGTGGGAACGAGCCTTCCGACTGGCGCTGCGCCCCATTTGGGTGCAGAACTCCAAGTGCTGCATG
GTTTGCAAGAAAGaattcagcttcttcatccgccCGCACCACTGCCGGTATGTTGCAACTTCACTGAAAGGGGTTAGAAAGACATGGTATTGATTTTGTG
ttgtttttgttgctgcagcaaatgtgGCACATGCATGTGTGACGAGTGCTCGGTGTTCGTCCCCCGACTGCCGATGCAAGGCTATTACGACGAAGTGCGC
ATCTGTCGGGACTGTTCACCAGTCAAGATCCAGCGATCGGCGCTGAAGCTGGGCACGCGCGTGTTGGTGTACGGCATTTTGGTGGGCAGAGTGGTGCAGg
ttgatgctgctgatgaCTCGGAGGACGGGAGGGCGTTCGTGAATGTGGAGCTGGTCAAGAAAGATAACCAACTGCGTCGGTTTGCACTGGAACACGTGGA
GCTTTACTCAGACGCGGTCCTATCGGCCAACCGCATTAAGAATGCCATCCGCCAACACCTTTCGTACGCTGTGTTTCGGACAcagctcaacttcaacacg
tgGAATTTGATCGAGACCGTCCAAGAGCAACGCACGGTGCAAATGGTGCGAATACTGAACAAATCGACGAGTATCAATGAGCTGCATTCGATGGTACCGA
TGCTCGGCTcgttcgagacgctgcaatTTCCTGACGACGATGTGTCTGAACAAGATCGTGTGAAGGAATCGCTTTCACATTATCGCGGTGTGCATGTGTC
ATTTCCGTTGCGGCTGGACACGGTGAAGCGACTGATTAATCAGTTCCGCAATGGAATTTTGTTGCACCGCGTCTTCGTGCGCCAGATTCTGGACGAGTCT
GAGAAGTTGTTTCAAAAGATGCACAAATCGCCAATGAACGAGATTGAGATCCCAATGGGTGTGCAGTTGGTCGTAGTGGGCGATCTCCACGGGCAGTTGG
AAGATCTGCTAACAATTATGGACAAGAACGGCGTGCCTAGCAGCAAAACGTGGTATCTCTTCAACGGCGACTTTGTGGATCGTGGTTCGCACGGAATCGA
GgtcattctgctgctgctgatatTTAAGTTATTGTACGCTGACTACGTATTCTTAAACCGTGGGAATCATGAGGAACGTATGATCAACGAGGTTTTCGGG
TTCGAGGATGAAGTCTACACGAAGTACGGAACGGACAacgatgaagttgctgggTGGAGTGGGCTGGGGTCATCGATGAACTACTCGCCGATGAAGCTAT
TCCAAATGTTCGAGACAGTGTTTGGTCTGTTTCCGCTCTTCGCGTTGCTTAACAAGCGCGTTTTTATTGTACACGGCGGTCTGAGCAATCACGAAAATGT
AacgatcgaggagctgcttcaacttAACCACAGACGTGAAATCCCGACGCAAGGCACGAGTCGAGCTGATGAGGTATTTACGCATCTATTGTGGAGCGAT
CCacgtgatgaagacggaTGGAAGCCATCAAGCCGAGGAGCAGGTGTGGAGTTTGGTCCTGACATTACGAAGGCCTTCTGTGCAAAAAATGGAATCAGCC
TTATTATTCGGTCTCACGA