Description :
From Genome Similarity Track
Location :
Scaffold_896:869- 7135
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_896-snap-gene-0.6HECT ubiquitin ligase
Pytir_DAOMBR486maker-pir_contig_896-fgenesh-gene-0.3Rraga protein

Sequence
6266 bases(100 bases per row)
AACTCAATCACGACGTCTTTGTGGCCTTCATGAGCAGCGATGTATAGCGGCGTTGCTCCATTCACTTTAGCTGCGTTCACATTGGCTCCCTGCGATATCA
ACTCAGTCACGACGTCTTTGTGTCCGTTCTGAGCAGCGATGAACAGCGGCGTTGCTCCATTCCTGTTCGCAGCTTCCATGTCGGCTCCATGTGATATCAA
CTCAGTCACGACATCCTTGTGTCCGTTCTGAACAGCGATATACAGCGGCGTTACTCCATCCACTGTGACAGCTTCCATGTTGGCTCCATGCGATATCAAC
TCAGCCACGATATCTTTGTGGTCATTCTTAGCAGCGATATACAGTGACGTTACTCCATTCTCTTTCGGGACGTTGACATTCGCTCCTAGTCGAAGAAGAG
CAATTGCCAGCTCGTGATGCCCAAATCTGCACGCAGCGATCAAAGGGGTGTCTCCCCCACCGTTCCCGACCTCGTTCAAGCGCGAAGCACTTGCTCGCTG
ACGCAGGAGCCCCAGTACGTGCTGTGTGTCCCCGTTGTGACAAGCGGCGAGCAGGAGCTCCAACGGGGATGGAGATGCCGACGCGCAGGCAACCTCCGTT
CCTCGCATGCTTCCTGGGTGGCGGGCGACTCGGCTGGGCTTTTGTGCTTTGTGCTTGTCGAGCGGGGGATTACAGGAGGGAAGGAAGGAGAATGAAGCCA
CTGAAGCCATGAATGCCCTCCGAATACTAGCCCTCCGAATACTAGCCCTCCGAACTCTTTTGATTGGCCCATTATTCCATTGAGTCACCTTTTTATGTTT
GCAATAAAAAGGTGATGCAATAGGGGGTTTTATAGTAGAGATTGTAAGGTGCGCCTAAAGTACCTAAACGCGCCAAAACCTTTAACGGCCTTGTTTAGTT
GCGCCAGACTGCACAAATTCTGGCTTCATTCAGCATACTGTCAATGTTGCTCTTTCAATAATTGATTGACCGAGGCTCCCAGTATTCCCCAACAACTGGA
CTATTGAGAACCGACTGCAATCTAGAGAGCACTGCAACATCACGGACCTTTTGGGGACATAAACTCGCTCAATCTCTGGATAAACCATCTCGAACATGCA
CATCTCAATGTCCCTGATACTCGCGACGTGTCTGATGAAGTGCTGCAAGATCTTTTTTTCCTTCGAAATCGCTTAGGTCTGGATGCCAGCATTGTGCAGA
CTCACTTGAGTTCGAGACTGAGATTATCAAAGCCATGAATGACAGCAAAGGCAAACTGACACAGGCAGAGAGAGAATCGACGACGTGCCATTTGCGTGAA
CAGCCACCAACACAATTCTCCCCGTCCCAAAAGAGCAAGGGGGGAAAACGCAATAGTGCCGAGACGAAAGAGCGCGAGAGAAAGCGTCGGCGCACCGCTG
CAGAGCTCGCTGATGCGCTCGCCAACCACACCAAGAACTGTGTGGATGAGCGCTCCGCCTACACTGATTTGTTGTGGCTTCCAGTCACCTTCGTGCAAGA
TCGAGCGACTGTTCTCCTCGACCAAGTGCATGTTAGAGTACTTGAAAAGAGTATGAGCGCCGAGACACTGAATAGAATCGTCCAGCTACGAATGAACTTG
TTGAGGTTCAGCGACATTTACTTGGCACGGGAAGTTGGTTTTTCAGGGACCGATTACCATTCGCATCCATATTGTAGGACCCGAAAGCACTGGTGCTTAT
TACTATTAACGCAGTACTTGTGCTTTCGAGGCGCCGAATTCGCAACTCGACTAAATGTGGTGCGGTCCCAGCGTATCAAGGAGTGTTTCTGTAGTACTAG
AATTTCCACCCAATCAAAAGAAGGAAGGTATGTCTGGCAAGAATGTCGCTTTAGTGTGCTTTCTGGCGAGCCTATCTGGCCAACATCTCTGTATCTTCAC
GATTCCTCTCCGGATCAGTCAAAGACATTGTGACGATGAAAAACAAGAGACTTCAGCAGATTTAGAGTATCAAATGAGTTTCTACAGAGCACCATCTTTC
ATCCTAAATGCCGCATCGCTACAGAATCTCAATAGTAGCAGATATAAAGAGTGGTTCTCGGTCAAGTCCTCGAATGGGGTTTTAGGGGAGGGCGGAATTC
AGTGGTACATTGCAGATTCAGAAAAAAAAAACTACCTCACTAACGAACAGATCAGCTGCAGACTATGAAACTCCTTGAAAGTGGTTTGCTGGAGCTCATT
TTGGAGTGATTCTGGCTCACAACATTGTCCTCTTTATGGCGCATTTTGGCTCACACACTGCATTTATTGCCCACATTCGTTCCTGAGCACCATCCGAGGT
GATGGGGAAAATCAGATTCCGCGTCAGCGCTCGCTATCAACTGTCAGTGGTGCGTCGAATCATTAGCGCGTGTGAGAGGAAAGCGTGGAGATCATGGATG
GCGCCGTGGTCTCGTTGCTGGCGTTCGCCGGCGTGGTGCTGCTGTTCGGCACCGCGTATTGGCTCCAGTGCCGCAAGAATCGCCCCATACGGCTGGAGGA
CCTGCGCGTGCCGCTGCTGCCAGCGTGAGTCAGTCAGTGGTAATGAGTGAGTGTGAGTGTTGCTGTTGAAGTGACTAACACACTCGTGTCTGTCTGGCTG
GCTGCGCTCCGGCGGTCTGCGTATATGTACTTTTGTTGCCAGCGCTGCGGGACATCGACTCCAGCTCGCATTGAGGTTTGTTATTGGGCTCGTCTGCCAC
CAACTCAACGAGAACAGCATGTATGATCAATCAACCGCATCGCTATGTCTGCTTGCTTTCTATTTGCGATTGTAGAGATGCTGAAGTTGGGTTCCTGCGA
TACGCGCTGTGCGAATTTGAGAACTTCAAGCGCTTCCCGTTCTNNNNNNNNNNTTATTTTTCTTTGTTGTAAGTCTGGAAATCCAGTTTAAAACGGATTT
ACATATGCGGACTTAAGCTTGCATGTATACATGTATACCTCCCATTCGACAGTGTGGGTCACCCACCCACAATGAGCGACCGACACATGCACAAGTACCA
CTTCGCCAGAATCAGCAACATGCTCACAGCACGAGCCTCCCGCACTCGCACTCGTCAACAGACCGACAAACACACAGACAGCTCCTCTGTCTATCTGGCC
AGCTAAAGCGAGACGCGCGTCATGGGGGACGGCGCCACGATCTCCGTGCTCGTGTGCGTGGCTGTGGCGCTGCTCTTCGGCGCCGCGTGCTGTCTCCAGT
GCCGCAAGGGTTCGACCTCGTTTATGGACGAGCTGCGAGTGCCTTTCGTACCTGTGTGAGTGCATAGTACCTACTGTGTCTGCTCTGCGTTTCCTGTGCT
GACTCATGTATGTGCGTTGCTTTGCTTGGTTATTACTACTTGCTAGACTGAGCGCGGTGGGACATCGACTGCAGCTCGCGATGAGGTACGTCCTTTGTCA
TCTTTCGCTAGGATGTTGTTTACATGCATGTGTGATAAGAGGTAGAGAGAGGCTCACACACGTATGCTCTCTCTCGTGTGTATCGCTAACGCGCGTTCGT
CGTGTCGATTGTTTAGAGACGCAGACGCGGGCTTCCTCCGCTGCGCGCTCTGTGGCTTTGAGAACTTCAAGCACTTCCCGTTCTGCAGTCTCTGCGGCGA
GGCGATAGCCCAAGCGAAGCAGTACGTGTACTACGAACAGCTGACGTCGTTTGCCTCGATAAATGGCACGGTGGGTACGCGGCAGTACACTTATCGACAG
AAGCGCGCGAGGTATGTAATGGAGCAAGCTACCTCCTATTTCGTATGCGCGTCAAATCCTAATGTCTACTGTGGTAATTGGGGTACCAGAAACCGCAAGG
AGTGGCTGCGGAAGCTCGATGTCGAGGGCAAGCTCTACTGGTTTCGCCAACGGATCGAGCACACGACAGGTGTTCCTCGGCTCGCGGGGTACACGCTGCT
ATTCACGGAAGACGAAGCGATTTTGGACAGACGCGCTGTTGCAGATGTGGAGGAGCGCTTGAACCAGGCAGAGAACTTGGATACAGCCTCACCAGCAGAG
GCAATAGAAGCCGAAGCAAGAGTGGTTTGCGACGTGTTCCCGCCGGACAGCGTGTTTCAAGAGGAAGAGCGGCTGCTGTCAGGGCAACCAGCCAACCGAG
AAGACGAAGACGAACAGCAACAGCAGTCTACAAGCTCAAAACCCTTTTCCAAGGAGGCGATTCTCCATCTTCTCAACACGCAGGTGGCACTGGTCAGCCA
CGTGCTCACCGGCTCGTGGCTCTCCGATCCAAAAGCATTTCCGGTGTACACTGCAGCAGATCGTGGCTACGTGATCCAGCTTCGAGACACGCTTCGCATT
GCGTTAGACAACTTCCCGACCAAGTTTGCGCACTTCGTCACCACAACAGTTGGGTTAACTGTCCCGCCCGTACGAGAGCTCGTCACGCTCAACATCCGCC
GCGAGAGCTTGCTCGCCAACTCGGTCGAGGCGCTGAGTGTGATCCCGCGAGAGCACATCCGCTCGTCGTTCCGCGTCAACTTTGTGGACGAGCGCGGCGT
TGACGCTGGCGGTATCTATCGCGAGTGGTGCGTGCTGCTGAACCAGAGTCTCGCGGACGCCGCGACTGGCGTCTTTCGGTGCGTCGACGTGCAGGAACAA
ATTTTCTACCTGAACTCCAACTCGGCGCACGACATCGGCGACGACCACCTCATGTACTTCTTCGCCACGGGTCGGCAGATCGGGAGAGCGCTGCTTGGAG
GTCACGTGCTGGGCTTTCACTTGGCGCTGCCGCTGCTCAAGATCATTTTGGGCTTGCCCGTCTCCTTCAACGACCTCGAGTACTTTGACCCGCAGGCGTA
CAAGAGCATGCTGTGGATCCTGTCGAGCGACGCGGTCGATACGCTGGACCTCAGTTTCAGCGTCATCGAGAAGCGAGGTGGAGAAATGGTGGAGGTCGAC
TTGATCGAGAACGGTCGCCACGTCAGCGTCACGAACGACAACAAGGAGCTGTATCTGCAGCGGCGGTTTCATTACCTGCTTTTCGAGAGCGTCTCGAGCC
AGCTCTACTGCTTCCTCAAGGGCGTGTACGAGGTGGTCCCGCAGGAGCTGCTCATGCTCTTTGACCCGGAGGAGTTCGACTACGTGCTCTGCGGCTCGGA
CGAGATTGACGTGGACGACTGGCAGAAGAACACGCGCCACAGCGGCAACTTGCACCCGAGCCACGACGTGGCGCNNNNNNNNNNTCGGCTCGAAGATACG
GCGAAAGAAGCACAAGAAGTCGAAGCGCAAGCACAGGAGTAGCTCGGACTCGTTTTCTGAAGTTGGTGAAATGTTCTTGGAATCTACGATGGCGGCAATC
AGAGTGGCTGGACTGCTAGGCTAGGCTAGGGGGAAAGAATGCTCCTTAATTCACGTCCGCAGCCCGGGTCATCGGTTTGTATTGCTATTTGTTAATCGTC
TGCTTTGCCACGAAATAAATCAACAATGTGTACCTGTCCTGAAGATTGCAGCTTCAAGTCTTGATCTCTTGGAAATGCGCTGCGTGTTTCATGTTTCTCG
TTTTGTCTCTGCACACTCAGAGCTCATGTACGTGTCGCTTAACTTGTCTGCTGAACATAACTCTCGAAAACTGGTCGCGCAGCCTTAATGTTCAAGTGGA
TCGTCGCCGGTTCTGTGGATGTTGAGAAAACACAAGCAGGTAGGTAGTAAATGAAAGCGTTAGGTCAATGCACACTCCAAGCAAGCAATAGAGTATATAA
GAAGAAGGTAGGGAATACACTTACGGATGTTCTGGTCCGACATGATCACCATGATGTACGTGTTCGTGGTGAAGAAGTCGATGAACGCGGTGAAGTTCGA
GTTGCGCACCTCCATGCCCTGGAACTGCGCCTGGGTCTTGCTGCAGCTGAGCTTGAACTGCTTGATAATATTGCTAATCTTTTCAAACCGGTGGATGTCG
CGGTGGTTCGCGTGCGTCGCGTGCGAGATTACCAAGAACGTCGCGCGCTCAAACAGCACCACTTCGTCCGCGTGGCAGATCGAACAAAAGTCGTTCAGGT
GCTTCTCCAGGTCCTGCATGTTCGGGATCAGCGAGTACACGATCGACGACCACGCGCGGTACAGCGTTTCATCCCAGATCGATGTGCCAAAGCACACAGT
CGGTAGTGAGCCCGTGCGCGCCAAGATCATCTCTTTCTTTTGCTCAAAGACCTACCAAGACAAAAAAATGAACCACAAAGCACCCCAGGTAACTCACGTA
TCAAAATCTGCTGCAAGGATGCTCATAACGTGCACGATATGCGCCATTTCCACTTACACGCTCGCG